Gutiérrez Cárdenas, Navarro Ibarra, Loeza Lara, Del Río Rodríguez, and Jiménez Mejía: Perfiles de resistencia a antibióticos y metales pesados en Pseudomonas aeruginosa potencialmente patógenas aisladas de agua de uso agrícola



Introducción

La agricultura consume aproximadamente el 70% del agua a nivel mundial, sin embargo, la creciente demanda del líquido por los centros urbanos e industriales ha disminuido su cantidad y calidad para uso agrícola. En principio, el uso de aguas residuales urbanas presenta beneficios en la agricultura por el ahorro en fertilizantes, debido al alto contenido de nutrientes presentes en ella. No obstante, también tienen desventajas por la presencia de contaminantes, los cuales pueden alterar las propiedades del suelo y representar riesgos a la salud por la presencia de bacterias patógenas (Ensink et al., 2002; Gatica y Cytrin, 2013). De acuerdo con esto último, en los suelos regados con aguas residuales se ha detectado la presencia de bacterias potencialmente patógenas de los géneros Pseudomonas, Stenotrophomonas, Acinetobacter, Escherichia, Klebsiella, Salmonella, Enterococcus y Shigella (Benami et al., 2013; Broszat et al., 2014).

El género Pseudomonas está representado por bacterias de vida libre que habitan principalmente en agua y suelo, en particular, P. aeruginosa es de gran interés debido a que es patógena de plantas y humanos, y por sus aplicaciones biotecnológicas potenciales (Silby et al., 2011). P. aeruginosa es un patógeno oportunista de humano siendo las principales infecciones por esta bacteria las de oído, de piel y de heridas, las cuales se adquieren a través del agua; también, es causa frecuente de infecciones en personas con fibrosis quística (Mena y Gerba 2009). Algunos de los factores de virulencia más importantes para el establecimiento y mantenimiento de infecciones por P. aeruginosa incluyen la producción de exoproteasas como la elastasa (lasB), fosfolipasas (plcH y plcN), toxinas (exoS y toxA) y producción de polisacáridos (algD) (Faraji et al., 2016).

Por otro lado, los antibióticos se utilizan tanto para el tratamiento de infecciones en humanos como en medicina veterinaria; de igual forma se usan como promotores de crecimiento animal y en acuacultura. Generalmente, estos compuestos se metabolizan parcialmente por los organismos, por lo que el resto termina en los sistemas de agua municipales y aquellos derivados de actividades agropecuarias. Como consecuencia, se ha observado un incremento en la resistencia a los antibióticos por las bacterias ambientales, lo que se ha tornado en un problema ecológico (Kümmerer, 2004). De acuerdo con lo anterior, P. aeruginosa presenta resistencia natural a una gran variedad de antibióticos, además de la capacidad que tiene para adquirir mecanismos adicionales de resistencia a través de elementos genéticos móviles, por lo cual se ha considerado un fenómeno de resistencia a antibióticos (Strateva y Yordanov, 2009; Lutz y Lee, 2011). Por otro lado, se ha observado que la contaminación de ambientes naturales con metales pesados tiene una función importante en la evolución, co-selección y distribución de genes de resistencia (Baker-Austin et al., 2006). La descarga de metales pesados junto con antibióticos en los cuerpos de agua de los sistemas de agua municipales, de actividades agrícolas o de acuacultura, promueve la co-selección de bacterias resistentes a esos compuestos (Seiler y Berendonk, 2012).

El noroeste de Michoacán es una de las zonas importantes en producción agropecuaria del Estado, sin embargo, uno de los principales problemas es la escasez de agua, aunado a la contaminación creciente de los cuerpos de agua superficiales por la mezcla de aguas residuales urbanas e industriales en los ríos y canales de riego. Además, las principales fuentes superficiales utilizadas para el riego de los cultivos en la zona presentan altos niveles de contaminantes químicos (López-Hernández et al., 2007; Sandoval-Moreno y Ochoa-Ocaña, 2010; Equihua et al., 2011). Sin embargo, a la fecha no se tiene conocimiento sobre las bacterias presentes en el agua y sus características de patogenicidad y resistencia. Por lo cual, el objetivo del presente trabajo fue aislar y estudiar la presencia de genes de virulencia así como los perfiles de resistencia a antibióticos y metales pesados en P. aeruginosa obtenidas de agua de uso agrícola.

Método

Aislamiento e identificación de P. aeruginosa

Se colectaron muestras de agua de los canales de riego en la región de la Ciénega de Chapala, Michoacán, en los municipios de Sahuayo (20°03’ de latitud norte y 102°43’ de longitud oeste); Venustiano Carranza (20°08’latitud norte y 102°35 minutos de longitud oeste); y Vista Hermosa (20°16’ de latitud norte y 102°28’ de longitud oeste). Las muestras se colectaron durante los meses de septiembre a diciembre del 2012 a una profundidad de 30 cm y 1 m del borde del canal de riego. Se depositaron en tubos estériles y se transportaron en hielo (4ºC) al laboratorio, donde fueron procesadas el mismo día de su colecta. Para la determinación del número total de bacterias viables en las muestras de agua, se hicieron diluciones decimales 1:10, 1:100 y 1:1000; de las últimas dos diluciones se sembraron 100 µl en cajas Petri con agar nutritivo (DIBICO). A partir de las colonias crecidas en agar nutritivo se seleccionaron 5 colonias independientes de cada muestra y se sembraron en agar Pseudomonas F. Se seleccionaron las colonias pigmentadas y fluorescentes bajo luz UV, a las cuales se les realizó tinción de Gram y se identificaron bioquímicamente, las principales pruebas que se realizaron fueron fermentación de glucosa y lactosa, así como producción de gas y H2S en agar Kligler con Hierro, IMViC (indol, rojo de metilo, Voges-Proskauer y citrato), oxidasa y catalasa (MacFaddin, 2000).

Identificación molecular de P. aeruginosa

La confirmación de la identidad de los aislados de P. aeruginosa se realizó por PCR de acuerdo con la literatura (Pirnay et al., 2002; Spilker et al., 2004). A partir de un cultivo crecido en agar nutritivo toda la noche se tomó una asada y se resuspendió en 20 μl de solución de lisis (0.25% de SDS y 0.05 M de NaOH). Después, la mezcla se hirvió por 15 min y se adicionaron 180 μl de agua destilada estéril. Las reacciones de amplificación se realizaron en 25 μl, conteniendo 1X Master mix (Promega), 0.5 μM de cada primer y 2 μl de extracto total de ADN (50 ng aproximadamente). Las condiciones de amplificación con los oligonucleótidos PA-GS-F/PA-GS-R (rDNA 16S) y PA-SS-F/PA-SS-R (rDNA 16S) (Tabla 1) fueron: un ciclo inicial de desnaturalización a 95°C por 5 min, seguido de 30 ciclos de desnaturalización a 94°C por 40 s, alineamiento a 55°C por 30 s y extensión a 72°C por 1 min. Las reacciones se terminaron con un ciclo de extensión a 72°C por 5 min. Para los primeros PS1/PS1 (oprI) y PAL1/PAL2 (oprL), las condiciones fueron similares a las anteriores, solo que la temperatura de alineamiento fue a 57°C. Los fragmentos amplificados se separaron en geles de agarosa al 1%, teñidos con bromuro de etidio y visualizados en un transiluminador Universal Hood (Bio-Rad).

Tabla 1

Oligonucleótidos utilizados en este trabajo

Oligo Secuencia 5´---3´ Tm(°C) Fragmento(pb)
PS1 ATGAACAACGTTCTGAAATTCTCTGCT 57 249
PS2 CTTGCGGCTGGCTTTTTCCAG
PAL1 ATGGAAATGCTGAAATTCGGC 57 504
PAL2 CTTCTTCAGCTCGACGCGACG
PA-GS-F GACGGGTGAGTAATGCCTA 54 617
PA-GS-R CACTGGTGTTCCTTCCTATA
PA-SS-F GGGGGATCTTCGGACCTCA 58 956
PA-SS-R TCCTTAGAGTGCCCACCCG
algD-F CGTCTGCCGCGAGATCGGCT 60 313
algD-R GACCTCGACGGTCTTGCGGA
LasB-F GGAATAGAACGAAGCGTTCTCCGAC 60 284
lasB-R TTGGCGTCGACGAACACCTCG
toxA-F CTGCGCGGGTCTATGTGCC 63 270
toxA-R GATGCTGGACGGGTCGAG
plcH-F GCACGTGGTCATCCTGATGC 60 608
plcH-R TCCGTAGGCGTCGACGTAC
plcN-F TCCGTTATCGCAACCAGCCCTAC 60 481
plcN-R TCGCTGTCGAGCAGGTCGAAC
exoS-F CGTCGTGTTCAAGCAGATGGTGCTG 60 444
exoS-R CCGAACCGCTTCACCAGGC

Distribución de genes de virulencia en P. aeruginosa

Para el análisis de la distribución de los genes de virulencia se realizaron amplificaciones por PCR con oligonucleótidos para algD (GDP-manosa 6-deshidrogenasa), lasB (elastasa), toxA (exotoxina A), plcH (fosfolipasa C hemolítica), plcN (fosfolipasa C no hemolítica) y exoS (exoenzyme S) de P. aeruginosa (Tabla 1). Las reacciones se realizaron en 25 μl conteniendo 1X Master mix (Promega), 0.2 μM de cada oligonucleótido y 2 μl de extracto de ADN. La amplificación de los fragmentos se realizó en las condiciones descritas previamente (Faraji et al., 2016).

Perfil de resistencia a los antimicrobianos

La resistencia a los antimicrobianos se determinó mediante el método de difusión en agar (CLSI, 2012), para lo cual las bacterias se crecieron en cajas Petri con agar Müeller-Hinton por 20 h a 37°C. A partir de los cultivos de toda la noche se prepararon suspensiones bacterianas en caldo Müeller-Hinton (Difco) a una turbidez equivalente al tubo 0.5 de la escala de McFarland, después 100 µl de los cultivos ajustados se sembraron uniformemente sobre la superficie de agar Müeller-Hinton (Difco). Para este análisis se utilizaron discos (Bio-Rad) impregnados con los siguientes compuestos: amikacina (AK, 30 µg), ampicilina (AM, 10 µg), levofloxacina (LEV, 5 µg), cefalotina (CF, 30 µg), cefotaxima (CTX, 30 µg), ceftriaxona (CRO, 30 µg), cloranfenicol (CL, 30 µg), gentamicina (GE, 10 µg), netilmicina (NET, 30 µg), nitrofurantoína (NF, 300µg), cefepime (FEP, 30 µg) y trimetoprim-sulfametoxazol (SXT, 25 µg). También se utilizaron discos de imipenem (IPM, 10 µg), ceftazidima (CAZ, 30 µg), aztreonam (ATM, 30 µg) ticarcilina (TIC, 75 µg) (DB BBL). Se midió el halo de inhibición y de acuerdo con los valores obtenidos, las bacterias se clasificaron como resistentes, intermedias o sensibles siguiendo los criterios del CLSI (CLSI, 2012). Como control se utilizó la cepa de P. aeruginosa ATCC 27853.

Determinación de la Concentración Mínima Inhibitoria (CMI) a antibióticos

Con el propósito de expandir el análisis de resistencia a los antibióticos se hicieron ensayos mediante dilución en agar para carbenicilina, kanamicina, estreptomicina y tetraciclina. Para lo cual las bacterias se crecieron en cajas Petri con agar Müeller-Hinton por 20 h a 37°C. A partir de los cultivos de toda la noche se prepararon suspensiones bacterianas como se indicó en el apartado anterior. Posteriormente, las suspensiones bacterianas se transfirieron a una placa de 48 pozos y con ayuda de un replicador metálico de 48 puntas (V & P Cientific) se inocularon las suspensiones bacterianas en cajas con las siguientes concentraciones 0, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, 128, 256, 512 µg/ml de carbenicilina (Sigma), estreptomicina (Sigma), kanamicina (Sigma) y tetraciclina (Sigma). Las cajas se incubaron a 37°C por 20 h, la CMI se determinó como la concentración más baja a la cual no se registró crecimiento visible de las bacterias. De acuerdo a los valores de la CMI, los aislados se clasificaron como resistentes o susceptibles. Para carbenicilina se consideraron resistentes los aislados con una CMI ≥512 µg/ml, para estreptomicina ≥16 µg/ml, para kanamicina ≥32 µg/ml y para tetraciclina ≥16 µg/ml (Salazar et al., 2001; CLSI, 2012).

Concentración mínima inhibitoria a metales

Para la determinación de la CMI se procedió en la preparación del inoculo de forma similar que para antibióticos. Las bacterias se inocularon en agar nutritivo con las siguientes concentraciones de metales 0. 0.5, 1, 2, 4, 5 y 6 mM de Cu+2 (CuSO4), Zn+2 (ZnSO4) y Ba+2 (BaCl2). Para Hg+2 (HgCl2), Ag+1 (AgNO3) y Cr+6 (K2Cr2O7) se probaron concentraciones de 0, 0.2 0.4, 0. 6, 0.8 y 1 mM; mientras que para Te+4 (K2TeO3) y Se+4 (Na2SeO3) se analizaron concentraciones de 0, 0.5, 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18 y 20 mM. Las cajas se incubaron por 24 hrs a 37°C, transcurrido el tiempo se observaron y se registró la CMI, es decir la concentración a la que ya no se observó crecimiento.

Resultados

Aislamiento e identificación de P. aeruginosa

Durante septiembre a diciembre del 2012 se colectaron 20 muestras de agua de fuentes superficiales destinadas al uso agrícola en el noroeste del estado de Michoacán, México. Los resultados obtenidos de bacterias viables presentes en las muestras de agua oscilaron entre 2x104 y 1.2x106 UFC/ml. A partir de 100 colonias seleccionadas al azar se estudiaron con más detalle 46 aislados que mostraron pigmentación verde y producción de fluorescencia bajo luz UV en agar Pseudomonas F. La identidad de las bacterias fue confirmada a nivel bioquímico donde se observó que no fermentaron lactosa ni glucosa y no produjeron gas ni H2S en agar Kligler con Hierro, también en INViC dieron (---+), crecieron en agar cetrimida, positivos para oxidasa y catalasa, producción de piocianina y fluoresceina. Las 46 bacterias fueron confirmadas a nivel molecular como P. aeruginosa mediante la amplificación de los genes oprI/oprL (Pirnay et al., 2002) y de fragmentos específicos del gen ribosomal 16S a nivel de género y especie (Spilker et al., 2004).

Distribución de genes de virulencia

Con el propósito de analizar el potencial de virulencia de los aislados bacterianos se determinó la distribución de 6 genes importantes para la virulencia en las 46 P. aeruginosa, se encontró que los más frecuentes fueron toxA y algD detectados en las 46 bacterias, los cuatro genes restantes se identificaron como sigue; lasB en 45, plcH en 44, plcN en 42, exoS en 41.

Análisis de resistencia a los antibióticos

Los datos obtenidos de susceptibilidad de las 46 P. aeruginosa contra 16 antibióticos mediante difusión en disco, indicaron que los mayores índices de resistencia se registraron para ampicilina, ceftriaxona y cloranfenicol con el 100% de aislados resistentes, seguido del 97.8% de resistentes a cefalotina, 93.5% a cefotaxima y nitrofurantoína, respectivamente; mientras que 47.8% fue resistente a trimetoprim-sulfametoxazol (Tabla 2). Por otro lado, todas las P. aeruginosa fueron susceptibles a ceftazidima, gentamicina, imipenem y ticarcilina, mientras que para amikacina, aztreonam, levofloxacina y netilmicina el 97.8% fue susceptible. También, altos índices de susceptibilidad se registraron para netilmicina 95.7 % y cefepima con el 73.9% (Tabla 2).

Tabla 2

Resultados del análisis de resistencia de P. aeruginosa contra 16 antibióticos.

Antibiótico P.aeruginosa
R(%) * I(%) S(%)
Amikacina (Ak) 1(2.2) - 45(97.8)
Ampicilina (Am) 46 (100) - -
Aztreonam (Atm) - 1 (2.2) 45 (97.8)
Cefalotina (Cf) 45 (97.8) - 1 (2.2)
Cefepinca (Fep) 6 (13) 6 (13) 34 (73.9)
Cefotaxima (Ctx) 43 (93.5) 2 (4.3) 1 (2.2)
Ceftazidima (Caz) - - 46 (100)
Ceftriaxona (Cro) 46 (100) - -
Cloranfenicol (Cl) 46 (100) - -
Gentamicina (Ge) - - 46 (100)
Imipenem (Ipm) - - 46 (100)
Levofloxacina (Lvx) 1 (2.2) - 45 (97.8)
Netilmicina (Net) 2 (4.3) - 44 (95.7)
Nitrofurantoína (Nf) 43 (93.5) 1 (2.2) 2 (4.3)
Ticarcilina (Tic) - - 46 (100)
Trimetoprim-Sulfametoxazol (Sxt) 22(47.8) 22 (47.8) 2 (4.3)

[i] *R, resistente; I, resistente intermedia; S, sensible.

El análisis de la CMI mostró que todas las bacterias tuvieron una CMI ≥32 y ≤128 µg/ml para carbenicilina, para kanamicina entre ≥128 y ≤256 µg/ml, para estreptomicina de entre ≥16 y ≤64 µg/ml y por último para tetraciclina de 64 µg/ml (Tabla 3). De acuerdo a estos resultados las bacterias que se inhibieron en concentraciones menores a las indicadas por la línea punteada se consideraron susceptibles y las que su CMI está por arriba de la línea se consideraron resistentes (Salazar et al., 2001; CLSI, 2012).

Tabla 3

Concentraciones Mínimas Inhibitorias de antibióticos.

2007-0705-ns-9-19-00097-gt3.jpg

[i] *Cb, Carbenicilina; Km, kanamicina; Stp, estreptomicina; Tc, tetreciclina.

Perfiles de resistencia

El análisis de los perfiles de resistencia mostró que las 46 P. aeruginosa se agruparon en 11 patrones de resistencia que van desde los 8 hasta los 11 antibióticos. De las cuales el 43.5% resistió 9 antibióticos, 39.1% resistió 10 compuestos, 10.9% resistió 11 antibióticos y 6.5% resistió 8 compuestos. Los dos patrones más frecuentes fueron los de resistencia a 9 antibióticos (AmCfClCroCtxKmNfStpTc) con 18 bacterias y el de resistencia a 10 antibióticos (AmCfClCroCtxKmNfStpStxTc) con 15 bacterias (Tabla 4).

Tabla 4

Patrones de resistencia de P. aeruginosa contra 20 antibióticos analizados.

Perfil de resistencia * No. aislados No. antibióticos
AmCfClCroCtxKmStpTc 1
AmCfClCroKmNfStpTc 1 8
AmClCroKmLevNfStpTc 1
AmCfClCroCtxKmNfStpTc 18
AmCfClCroCtxKmStpStxTc 1 9
AmCfClCroFepKmStpStxTc 1
AmCfClCroCtxKmNfStpStxTc 15
AmCfClCtxCroKmNetNfStpTc 2 10
AmCfClCroCtxFepKmNfStpTc 1
AmCfClCroCtxFepKmNfStpStxTc 4 11
AkAmCfClCroCtxKmNfStpSxtTc 1

[i] * Abreviaciones: Ak amikacina, Am ampicilina, Cf cefalotina, Cl cloranfenicol, Cro ceftriaxona, Ctx cefotaxima, Fep cefepima, Ge gentamicina, Km kanamicina, Lev levofloxacina, Net netilmicina, Nf nitrofurantoína, Stp estreptomicina, Sxt trimetoprima-sulfametoxazol, Te tetraciclina.

Tolerancia a metales pesados

Se encontró que las P. aeruginosa mostraron tolerancia principalmente a Cu+2, Zn+2, Ba+2 y Se+4. En este sentido, para Cu+2 la CMI más alta fue de 3 mM en el 82.6% de las bacterias; mientras que para Zn+2, la CMI más alta fue de 6 mM en el 47.8% de las bacterias; para el Ba+2, la mayor CMI fue de 4 mM en el 21.7%; para Pb, la CMI fue de 2.5% en el 100% y por último; para Se+4, el 100% de las bacterias toleró hasta una concentración de 20 mM. Por otro lado, las bacterias mostraron susceptibilidad para Cr+6, Hg+2, Ag+2, y Te+4 (Tabla 5).

Tabla 5

CMI de las P. aeruginosa frente a diversos metales.

Metal CMI (mM) No. aislados
Cu+2 2 8
3 38
3 4
Zn+2 4 6
5 14
6 22
Cr+6 0.1 10
0.2 36
Hg+2 0.02 46
Ba+2 3 36
4 10
Ag+1 0.1 46
Pb+2 2.5 46
Se+4 >20 46
Te+4 0.5 46

Discusión o Conclusiones

El riego agrícola con agua de mala calidad, por ejemplo mezcladas con aguas residuales domésticas, tiene la ventaja de proporcionar materia orgánica al suelo. Sin embargo, esto también contribuye al desarrollo de microorganismos tanto nativos del suelo como de aquellos presentes en el agua, modificando así sus poblaciones (Broszat et al., 2014).

P. aeruginosa es una bacteria que comúnmente se encuentra en el agua residual doméstica, suelos agrícolas y drenajes de corrales (Mena y Gerba, 2009). De acuerdo con esto, en este trabajo se encontró que de 100 bacterias seleccionadas al azar 46 se identificaron como P. eruginosa, ya que todas las muestras fueron positivas para esta bacteria. Esto concuerda con lo reportado en la literatura en donde se ha observado que P. aeruginosa es una bacteria ubicua en sistemas acuáticos contaminados (Mena y Gerba, 2009). La presencia de este tipo de bacterias en agua de uso agrícola representa riesgos potenciales para las personas que entren en contacto con ésta, como los agricultores, ya que en todas las bacterias se detectó alta frecuencia de genes de virulencia importantes durante el proceso infeccioso; algD y toxA (100%), lasB (97.8%), plcH (95.6%), plcN (91.3%) y exoS (89.3%). Estos resultados concuerdan en parte con lo reportado por Pitondo-Silva et al. (2016), quienes identificaron diversos genes de virulencia en P. aeruginosa aisladas de suelo y encontraron que los más frecuentes fueron lasB (76%), plcH (74%) y algD (52%). En otro estudio se encontró que P. aeruginosa aisladas de muestras de agua para beber mostraron prevalencia de genes de virulencia como sigue exoS (20.9%), ecfX (100%), exoS (97.7%), phzM (93%), toxA (93%) y lasB (100%) (Wu et al., 2016).

Por otro lado, el uso de antibióticos tanto en humanos como en animales ha incrementado la concentración de estos compuestos en los cuerpos de agua, lo cual trae como consecuencia un incremento en el surgimiento de bacterias resistentes a esos compuestos (Zhang et al., 2009). De tal forma que la descarga en aguas residuales tanto domésticas como de origen agropecuario favorece la co-selección de bacterias resistentes a antibióticos y metales pesados (Seiler y Berendonk, 2012). En este sentido los aislados de P. aeruginosa fueron multirresistentes ya que resistieron entre 8 y 11 compuestos distintos, de acuerdo con esto se clasificaron en 11 patrones de resistencia a antibióticos. Se ha reportado que las P. aeruginosa presentan altos niveles de resistencia tanto intrínseca como adquirida a diversos antibióticos (Strateva y Yordanov, 2009). Además, otros autores han reportado multirresistencia en P. aeruginosa aislada de muestras colectadas de plantas tratadoras de aguas residuales, en donde se encontró que las bacterias presentaron resistencia de 5 a 11 antibióticos destacando la resistencia a compuestos beta-lactámicos (100%) (Odjadjare et al., 2012). De igual forma, se ha encontrado resistencia a antibióticos en P. aeruginosa aislada de muestras de agua de piscinas y jacuzzi. Los autores reportan que el 96% de las bacterias estudiadas fueron multirresistentes principalmente a los compuestos anti-Pseudomonas de uso clínico (Lutz y Lee, 2011).

Asimismo, las bacterias analizadas en este trabajo mostraron resistencia a los metales Cu, Zn, Pb, Ba y Se lo cual concuerda con lo previamente observado que la presencia de metales pesados favorece la selección o co-selección de bacterias resistentes a los antibióticos (Seiler y Berendonk, 2012). En este sentido se ha observado que aislados de P. aeruginosa resistentes a metales pesados obtenidas de muestras de suelo mostraron resistencia a antibióticos, lo cual confirma diversas observaciones que indican la co-selección de ambos mecanismos de resistencia (Pitondo-Silva et al., 2016).

En conclusión, de acuerdo con los resultados presentados se encontró que las P. aeruginosa presentes en el agua de uso agrícola en el área de estudio representan un gran riesgo para la salud de las personas por la presencia de genes de virulencia, y por la multirresistencia a los antibióticos que se encontró en estos aislados. Además, las bacterias multirresistentes a los antibióticos también presentaron resistencia a metales pesados, lo cual sugiere que el medio acuático estudiado favorece la co-selección de estos fenómenos.

Agradecimientos

A la Universidad de La Ciénega del Estado de Michoacán de Ocampo, por el financiamiento y facilidades brindados para el desarrollo del presente trabajo.

Referencias

1

Baker-Austin, C., Wright, M. S., Stepanauskas, R., McArthur, J. V. (2006). Co-selection of antibiotic and metal resistance.Trends in Microbiology,14(4), 176-182.

C. Baker-Austin M. S. Wright R. Stepanauskas J. V. McArthur 2006Co-selection of antibiotic and metal resistanceTrends in Microbiology144176182

2

Benami, M., Gross, A., Herzberg, M., Orlofsky, E., Vonshak, A., Gillor, O. (2013). Assessment of pathogenic bacteria in treated graywater and irrigated soils.Science of the Total Environment,458, 298-302.

M. Benami A. Gross M. Herzberg E. Orlofsky A. Vonshak O. Gillor 2013Assessment of pathogenic bacteria in treated graywater and irrigated soilsScience of the Total Environment458298302

3

Broszat, M., Nacke, H., Blasi, R., Siebe, C., Huebner, J., Daniel, R., Grohmann, E. (2014). Wastewater irrigation increases the abundance of potentially harmful Gammaproteobacteria in soils in Mezquital Valley, Mexico.Applied and Environmental Microbiology,80(17), 5282-5291.

M. Broszat H. Nacke R. Blasi C. Siebe J. Huebner R. Daniel E. Grohmann 2014Wastewater irrigation increases the abundance of potentially harmful Gammaproteobacteria in soils in Mezquital Valley, MexicoApplied and Environmental Microbiology801752825291

4

CLSI, Clinical and Laboratory Standards Institute, 2012: M2-A11: Performance Standards for Antimicrobial Disk Susceptibility Test: Approved Standard- Eleventh Edition. Clinical Laboratory Standards Institute, Wayne, PA.

CLSI, Clinical and Laboratory Standards Institute 2012M2-A11: Performance Standards for Antimicrobial Disk Susceptibility Test: Approved StandardEleventhClinical Laboratory Standards InstituteWayne, PA

5

Equihua-Pimentel JL, Velázquez-Machuca MA, Sánchez-Rodríguez M, Seefoó-Luján JL. Gestión y calidad del agua en la cuenca del río Duero, Michoacán. En: Spring OU. Coordinadora. Retos de la investigación del agua en México. Cuernavaca, México, CRIM-UNAM. 2011. p. 521-530.

JL Equihua-Pimentel MA Velázquez-Machuca M Sánchez-Rodríguez JL. Seefoó-Luján Gestión y calidad del agua en la cuenca del río Duero, Michoacán Spring OU Retos de la investigación del agua en México.Cuernavaca, MéxicoCRIM-UNAM2011521530

6

Faraji, F., Mahzounieh, M., Ebrahimi, A., Fallah, F., Teymournejad, O., Lajevardi, B. (2016). Molecular detection of virulence genes in Pseudomonas aeruginosa isolated from children with Cystic Fibrosis and burn wounds in Iran.Microbial Pathogenesis,99, 1-4.

F. Faraji M. Mahzounieh A. Ebrahimi F. Fallah O. Teymournejad B. Lajevardi 2016Molecular detection of virulence genes in Pseudomonas aeruginosa isolated from children with Cystic Fibrosis and burn wounds in IranMicrobial Pathogenesis9914

7

Gatica, J., Cytryn, E. (2013). Impact of treated wastewater irrigation on antibiotic resistance in the soil microbiome.Environmental Science and Pollution Research,20(6), 3529-3538.

J. Gatica E. Cytryn 2013Impact of treated wastewater irrigation on antibiotic resistance in the soil microbiomeEnvironmental Science and Pollution Research20635293538

8

Ensink, J. H., Van Der Hoek, W., Matsuno, Y., Munir, S., Aslam, M. R. (2002).Use of untreated wastewater in peri-urban agriculture in Pakistan: Risks and opportunities. International Water Management Institute, 64, 1-22.

J. H. Ensink W. Van Der Hoek Y. Matsuno S. Munir M. R. Aslam 2002Use of untreated wastewater in peri-urban agriculture in Pakistan: Risks and opportunitiesInternational Water Management Institute64122

9

Kümmerer, K. (2004). Resistance in the environment.Journal of Antimicrobial Chemotherapy,54(2), 311-320.

K. Kümmerer 2004Resistance in the environmentJournal of Antimicrobial Chemotherapy542311320

10

López-Hernández M, Ramos-Espinosa MG, Carranza-Fraser J. (2007). Análisis multimétrico para evaluar contaminación en el río Lerma y lago de Chapala, México. Hidrobiológica, 7:17-30.

M López-Hernández MG Ramos-Espinosa J. Carranza-Fraser 2007Análisis multimétrico para evaluar contaminación en el río Lerma y lago de Chapala, MéxicoHidrobiológica71730

11

Lutz, J. K., Lee, J. (2011). Prevalence and antimicrobial-resistance of Pseudomonas aeruginosa in swimming pools and hot tubs.International Journal of Environmental Research and Public Health, 8(2), 554-564.

J. K. Lutz J. Lee 2011Prevalence and antimicrobial-resistance of Pseudomonas aeruginosa in swimming pools and hot tubsInternational Journal of Environmental Research and Public Health82554564

12

MacFaddin JF. Pruebas bioquímicas para la identificación de bacterias de importancia clínica, 3ª edición, Montevideo, Uruguay, Panamericana, 2000.

JF MacFaddin Pruebas bioquímicas para la identificación de bacterias de importancia clínica3ªMontevideo, UruguayPanamericana2000

13

Mena, K. D., Gerba, C. P. (2009). Risk assessment of Pseudomonas aeruginosa in water. InReviews of Environmental Contamination and Toxicology, 201, 71-115.

K. D. Mena C. P. Gerba 2009Risk assessment of Pseudomonas aeruginosa in waterReviews of Environmental Contamination and Toxicology20171115

14

Odjadjare, E. E., Igbinosa, E. O., Mordi, R., Igere, B., Igeleke, C. L., Okoh, A. I. (2012). Prevalence of multiple antibiotics resistant (MAR) Pseudomonas species in the final effluents of three municipal wastewater treatment facilities in South Africa.International Journal of Environmental Research and Public Health , 9(6), 2092-2107.

E. E. Odjadjare E. O. gbinosa R. Mordi B. Igere C. L. Igeleke A. I. Okoh 2012Prevalence of multiple antibiotics resistant (MAR) Pseudomonas species in the final effluents of three municipal wastewater treatment facilities in South AfricaInternational Journal of Environmental Research and Public Health9620922107

15

Pirnay, J. P., De Vos, D., Cochez, C., Bilocq, F., Vanderkelen, A., Zizi, M., Ghysels, B., Cornelis, P. (2002). Pseudomonas aeruginosa displays an epidemic population structure.Environmental Microbiology, 4(12), 898-911.

J. P. Pirnay D. De Vos C. Cochez F. Bilocq A. Vanderkelen M. Zizi B. Ghysels P. Cornelis 2002Pseudomonas aeruginosa displays an epidemic population structureEnvironmental Microbiology412898911

16

Pitondo‐Silva, A., Gonçalves, G. B., Stehling, E. G. (2016). Heavy metal resistance and virulence profile in Pseudomonas aeruginosa isolated from Brazilian soils.APMIS,124(8), 681-688.

A. Pitondo‐Silva G. B. Gonçalves E. G. Stehling 2016Heavy metal resistance and virulence profile in Pseudomonas aeruginosa isolated from Brazilian soilsAPMIS1248681688

17

Salazar, D., Hernández, Y., Palma, S., González, A., Reyes, T. (2001). Actividad antimicrobiana de doce fármacos frente a cepas de Pseudomona aeruginosa de origen clínico.Bioquimia,26(4), 79-84.

D. Salazar Y. Hernández S. Palma A. González T. Reyes 2001Actividad antimicrobiana de doce fármacos frente a cepas de Pseudomona aeruginosa de origen clínicoBioquimia2647984

18

Sandoval-Moreno, A., & Ochoa-Ocaña, M. A. (2010). Grupos locales, acceso al agua y su problemática de contaminación en la ciénega de Chapala, Michoacán.Economía, Sociedad y Territorio,10(34), 683-719.

A. Sandoval-Moreno M. A. Ochoa-Ocaña 2010Grupos locales, acceso al agua y su problemática de contaminación en la ciénega de Chapala, MichoacánEconomía, Sociedad y Territorio1034683719

19

Seiler, C., Berendonk, T. U. (2012). Heavy metal driven co-selection of antibiotic resistance in soil and water bodies impacted by agriculture and aquaculture.Frontiers in Microbiology, 3:399.

C. Seiler T. U. Berendonk 2012Heavy metal driven co-selection of antibiotic resistance in soil and water bodies impacted by agriculture and aquacultureFrontiers in Microbiology3399399

20

Silby, M. W., Winstanley, C., Godfrey, S. A., Levy, S. B., Jackson, R. W. (2011). Pseudomonas genomes: diverse and adaptable.FEMS Microbiology Reviews,35(4), 652-680.

M. W. Silby C. Winstanley S. A. Godfrey S. B. Levy R. W. Jackson 2011Pseudomonas genomes: diverse and adaptableFEMS Microbiology Reviews354652680

21

Spilker, T., Coenye, T., Vandamme, P., LiPuma, J. J. (2004). PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients.Journal of Clinical Microbiology,42(5), 2074-2079.

T. Spilker T. Coenye P. Vandamme J. J. LiPuma 2004PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patientsJournal of Clinical Microbiology42520742079

22

Strateva, T., Yordanov, D. (2009). Pseudomonas aeruginosa-a phenomenon of bacterial resistance.Journal of Medical Microbiology,58(9), 1133-1148.

T. Strateva D. Yordanov 2009Pseudomonas aeruginosa-a phenomenon of bacterial resistanceJournal of Medical Microbiology58911331148

23

Wu, Q., Ye, Y., Li, F., Zhang, J., Guo, W. (2016). Prevalence and genetic characterization of Pseudomonas aeruginosa in drinking water in Guangdong Province of China.LWT-Food Science and Technology,69, 24-31.

Q. Wu Y. Ye F. Li J. Zhang W. Guo 2016Prevalence and genetic characterization of Pseudomonas aeruginosa in drinking water in Guangdong Province of ChinaLWT-Food Science and Technology692431

24

Zhang, XX, Zhang T, Fang HHP. Antibiotic resistance genes in water environment. Applied Microbiology and Biotechnology, 2009; 82:397-414

XX Zhang T Zhang HHP Fang Antibiotic resistance genes in water environmentApplied Microbiology and Biotechnology200982397414



Desarrollado por eScire - Consultoría, Tecnologías y Gestión del Conocimiento SA de CV

Refbacks

  • There are currently no refbacks.


Copyright (c) 2017 Nova Scientia

Scope

Nova Scientia is a multidisciplinary, electronic publication that publishes biannually in the months of May and November; it is published by the Universidad De La Salle Bajío and aims to distribute unpublished and original papers from the different scientific disciplines written by national and international researchers and academics. It does not publish reviews, bibliographical revisions, or professional applications.

Nova Scientia, year 10, issue 21, November 2018 – April 2019, is a biannual journal printed by the Universidad De La Salle Bajío, with its address: Av. Universidad 602, Col. Lomas del Campestre, C. P. 37150, León, Gto. México. Phone: (52) 477 214 3900, e-mail: http://nova_scientia.delasalle.edu.mx. Chief editor: Ph.D. Ramiro Rico Martínez. ISSN 2007 - 0705. Copyright for exclusive use No. 04-2008-092518225500/102, Diffusion rights via computer net 04 - 2008 – 121011584800-203 both granted by the Instituto Nacional del Derecho de Autor.

Editor responsible for updating this issue: Direction of Research Department of the Universidad De La Salle Bajío, last updated on November 23th, 2018.