Huella genética de variedades de fresa obtenidas en el Colegio de Postgraduados, México
Resumen

En un programa de mejoramiento genético de fresa (Fragaria × ananassa) es importante contar con la metodología para evaluar la integridad genética de la planta en todas las etapas de incremento, desde diferentes criterios, como el fisiológico, morfológico y el molecular; para este propósito, una de las herramientas más apropiadas son los marcadores moleculares denominados Secuencias Simples Repetidas del inglés Simple Sequence Repeats (SSR), ya que permiten, por ejemplo, identificar poblaciones con una diversidad genética reducida, revelar genealogías, conocer el grado de parentesco entre individuos, proporcionar elementos sólidos en la defensa de la propiedad intelectual, evaluar la pureza del material vegetal, identificar el grado de variación somaclonal y evitar la mezcla de material vegetal en bancos de germoplasma. En este sentido, el presente estudio tuvo como objetivo obtener la huella genética de las variedades de fresa CP0201, CP0204, CP0615, CPLE7 desarrolladas en el Colegio de Postgraduados y como testigo la variedad Festival, desarrollada en Florida, USA, con el uso de nueve loci de microsatélites (SSR). El proceso incluyó la extracción de ADN a partir de tejido foliar de fresa, así como de la amplificación mediante PCR de punto final de los loci SSR agrupados en reacciones multiplex. Los productos de PCR fueron separados mediante electroforesis capilar y su tamaño en pares de bases se determinó con el programa GeneMapper® v. 4. A partir de las frecuencias alélicas se calcularon las matrices de distancia con los coeficientes de Jaccard y Dice. Se encontraron 63 alelos distintos, cada par de iniciadores amplificó entre 3 y 12 alelos. Los marcadores que presentaron mayor número de alelos fueron EMFn181 (11 alelos) y EMFv104 (12 alelos). Se generó la huella genética de cada variedad. Mediante los perfiles alélicos se encontraron diferencias entre las variedades CP0615, CPLE7 y Festival; CP0201 y CP0204 tuvieron una huella genética similar, ya que están emparentadas a través de su progenitor femenino; el índice de diversidad alélica dentro de las poblaciones varió de 3.96 a 5.93. Las variedades tuvieron un índice de uniformidad bajo debido al alto nivel de polimorfismo de los marcadores usados.

Abstract

In a breeding program for strawberry (Fragaria × ananassa) it is important to have a methodology to evaluate the genetic integrity of the plant in all the stages of increase, from different criteria, such as morphological, physiological and molecular; for this purpose one of the most appropriate tools are the Simple Sequence Repeats (SSR`s) molecular markers, since they allow, for example, identifying populations with a reduced genetic diversity, revealing genealogies, knowing the degree of relatedness between individuals, providing solid elements in the defense of intellectual property, evaluation of the purity of the plant material, identification of somaclonal variation and to avoid the mixture of plant material in germplasm banks. In this sense the objective of this study was to obtain the genetic fingerprint of strawberry varieties CP0201, CP0204, CP0615, CPLE7 developed at Colegio de Postgraduados and variety Festival developed at Florida, US, with the use of nine microsatellite (SSR`s) loci. The process included the DNA extraction from strawberry leaf tissue, as well as the amplification by means of PCR of the SSR`s loci grouped in multiplex reactions. The PCR products were separated by capillary electrophoresis and their size in base pairs was determined with the GeneMapper® v. 4 software. From the allele frequencies distance matrices were calculated the Jaccard and Dice coefficients. 63 different alleles were found, each pair of primers amplified between 3 and 12 alleles. The markers that presented the highest number of alleles were EMFn181 (11 alleles) and EMFv104 (12 alleles). The genetic fingerprint of each variety was generated. Differences between the CP0615, CPLE7 and Festival were found based on their allelic profiles; CP0204 and CP0201 had a similar genetic fingerprint, since they are related through their female parent; the allelic diversity index within the populations ranged from 3.96 to 5.93. The varieties had a low uniformity index due to the high level of polymorphism of the markers used.

Palabras clave:
    • Fragaria × ananassa;
    • perfil alélico;
    • SSR, marcadores moleculares;
    • diversidad genética.
Keywords:
    • Fragaria × ananassa;
    • allelic profile;
    • SSR, molecular markers;
    • genetic diversity.

Introducción

El género Fragaria forma parte de la familia Rosaceae, una de las más importantes a nivel mundial, que agrupa aproximadamente a 3,000 especies de 107 géneros; presenta diferentes niveles de ploidia, desde diploides, tetraploides, hexaploides y octaploides. Fragaria × ananassa es una de las especies más ampliamente cultivadas, de naturaleza octaploide. Se originó a partir de la cruza de dos especies silvestres octaploides: F. virginiana y F. chiloensis. Todos los esfuerzos de mejoramiento genético en el cultivo de la fresa partieron de esta población inicial, por lo que la fresa tiene una base genética reducida (Hummer, 2008, 15; Hancock, 2008, 394; Ather et al., 2018, 221).

En México existen programas de mejoramiento genético tanto públicos (Colegio de Posgraduados e Instituto Nacional de Investigaciónes Forestales Agrícolas y Pecuarias) como privados (Driscoll´s, Berrimex, Splendor, Sunbelle, Agrana, Planamerica) que han intentado dar solución a la problemática de los productores y consumidores, generar variedades que se adapten a diferentes condiciones climáticas. En este contexto, surge la necesidad de desarrollar una variedad para clasificarla a nivel morfológico, fisiológico y molecular, con la finalidad de mantener su integridad genética en todas y cada una de las etapas de incremento del germoplasma; para este propósito una de las herramientas más efectivas son los marcadores moleculares (Whitaker, 2011, 116), que permiten identificar poblaciones con una diversidad genética reducida y más vulnerables a un posible cambio ambiental; así como, distinguir subpoblaciones genéticamente diferenciadas del resto, inferir genealogías y conocer el grado de parentesco entre individuos (Graham et al., 1996, 402; Powell et al., 1996, 226; Degani et al., 2001, 2; Sargent et al., 2006, 1350; Carbone et al., 2006, 128; Dangl et al., 2007, 118; Rousseau-Gueutin et al., 2008, 2046; Gil-Ariza et al., 2009, 338; Muhammad et al, 2018, 270). Adicionalmente los marcadores moleculares se utilizan para la identificación varietal, protección de la propiedad intelectual, evaluación de la pureza del material vegetal en viveros, la identificación de variación somaclonal en lotes de cultivo in vitro y para evitar la mezcla de material vegetal en bancos de germoplasma (Firas y Abdulkareem, 2015, 121).

Para la identificación varietal mediante marcadores moleculares en fresa se han usado diversas técnicas como los AFLP´s (del inglés Amplified Fragment Lenght Polymorphisms) y RAPD’s (del inglés Random Amplified Polymorphic DNA), (Powell et al., 1996, 225; Degani et al., 1998, 247; Congiu et al., 2000, 239; Degani et al., 2001, 1; Arnau et al., 2001, 302; Tyrka et al., 2002, 273; Garcia et al., 2002, 76; Melese et al., 2018, 2), además de los microsatélites SSR (del inglés Simple Sequence Repeat), que son arreglos de di-, tri- o tetra- nucleótidos, posicionados uno enseguida del otro, muy abundantes en todo el genoma eucariótico, codominantes, expresan varios alelos por locus, tienen un alto nivel de polimorfismo y su costo es menor en comparación con marcadores de generaciones anteriores (Arnau et al., 2002, 70; Shimomura y Hirashima, 2006, 399; González y Aguirre, 2007, 568; Debnath y Ricard, 2009, 83; Amom y Nongdam, 2017, 2). Los SSR se han convertido en los marcadores preferidos para la identificación varietal tanto en el sector público como en el privado (Debnath et al., 2008, 314; Nunes et al., 2013, 451) son robustos, confiables, reproducibles y consistentes como identificadores genotípicos; también se han usado en la caracterización de poliploides (Holton et al., 2002, 66; Beovides et al., 2006, 11; Han et al., 2006, 431; Zhang et al., 2010, 134; Novo et al., 2010,110; Hwang et al., 2011, 288; Nantoumé et al., 2013, 2131; Sánchez-Sevilla et al., 2015, 22), en la caracterización molecular del cultivo de fresa (Arnau et al., 2002, 69; Sargent et al., 2003, 550; Hadonou et al., 2004, 430; Carrasco et al., 2013, 1196) y se han utilizado para distinguir entre variedades de fresa altamente relacionadas (Shimomura y Hirashima, 2006, 399; Carrasco et al., 2007, 504; Dangl et al., 2007, 120; Debnath et al., 2008, 316; Hussein et al., 2008, 678; Debnath y Ricard, 2009, 85; Debnath, 2014, 338; Kim et al., 2019, 70). De esta manera, la caracterización molecular representa una herramienta complementaria a la caracterización morfológica, donde se puede evaluar la integridad genética del material vegetal de manera rápida y eficaz. Por lo anterior el objetivo de la presente investigación fue obtener la huella genética de un grupo de variedades de fresa desarrolladas en el Colegio de Postgraduados mediante el uso de SSR.

Método

Material vegetal

Se analizaron las variedades de fresa CP0201 (Zamorana), CP0204 (Jacona), provenientes de la cruza de la variedad Camarosa y una selección avanzada, ambas están registradas en el catálogo nacional de variedades vegetales del Servicio Nacional de Inspección y Verificación de Semillas (Rodríguez-Bautista et al., 2012, 115; SNICS, 2018, 9), CPLE7, CP0615, selecciones avanzadas desarrolladas en el Colegio de Postgraduados y la variedad comercial Festival desarrollada en el año 2000 por la Universidad de Florida en los Estados Unidos de América (Whitaker et al., 2011, 556).

Extracción de ADN

Se utilizaron hojas recientemente expandidas de 10 plantas de cada variedad cultivadas en condiciones de invernadero y se colocaron a -20 °C antes del proceso de extracción de ADN. Para el proceso de extracción se usó el kit comercial ChargeSwitch® (Invitrogene, 2006, 13), a partir de 100 mg de tejido foliar, 600 µL de lisis, 100 µL de reactivo A, el cual se modificó con PVP 40 000 en lugar de PVP 10 000, 2µL de ARNasa y 400 µL de buffer de precipitación (Nunes et al., 2011, 1384). La separación y elución del ADN se hizo con un robot de extracción KingFisher Flex Magnetic Particle Processor (Thermo Scientific, Waltham, MA, USA).

La concentración expresada en ng µL-1 y la calidad del ADN en términos de densidad óptica de absorbancia (DO260/280) se midió con un espectrofotómetro de ultra bajo volumen (NanoDrop® 2000, Thermo Scientific, Waltham, MA, USA), se verificó que la relación 260/280 se mantuviera entre 1.4 y 1.8; después se ajustó a una concentración de 20 ng µL-1 para su uso en la amplificación de los marcadores.

Amplificación por PCR

Para la amplificación de la reacción en cadena de la polimerasa (PCR, del inglés, Polymerase Chain Reaction) se usaron diez repeticiones de producto de DNA de cada variedad, por lo que se analizaron 100 muestras. Las reacciones se modificaron a partir de la metodología de Sargent et al. (2003, 552) y la de Hilmarsson et al., (2017, 5).

En la reacción de PCR se usó un volumen total de 25 µL con 20 ng µL-1 de ADN genómico, 1.5 µM de MgCl2, 10 pmol de cada iniciador, 1X PCR Buffer, 0.2 µM de DNTPs, una unidad de ADN polimerasa (kit GoTaq®, Promega). La configuración del programa de PCR con los tiempos modificados constó de un paso de desnaturalización inicial de 95 °C por 4 min; 30 ciclos de desnaturalización de 95 °C por 1 min, alineamiento por 2 min a las temperaturas de alineamiento (Ta) óptimas para cada primer determinadas por pruebas de PCR en gradiente, extensión de 72 °C por 2 min; por último extensión final a 72 °C por 60 min, lo anterior se realizó en un termociclador BIORAD Modelo C1000, Hercules, CA, USA.

Se utilizó un conjunto de nueve pares de iniciadores SSR (Cuadro 1), desarrollados para fresa diploide (Sargent et al., 2003, 551) y probados en fresa octaploide (Govan et al., 2008, 654; Brunings et al., 2010, 66; Sargent et al., 2012, 1231; Kim et al., 2019, 111). Los iniciadores se agruparon en reacciones multiplex usando el programa Multiplex Manager (Holleley y Geerts, 2009, 512); se tomó como base las temperaturas de alineamiento, determinadas de manera empírica para cada uno de los iniciadores.

Secuencia de los iniciadores y etiqueta fluorescente asignada
Grupo Marcador Secuencia 5’→3’ Etiqueta
1 EMFn182 F GCAACAAAGGAGGTTAGAGTCG [6-FAM]
R TGGTGAGTGCTCATTGTTCC
EMFvi166 F ACCGACAGCTGAGTTAGAGGAG [6-FAM]
R AGTCATAGGACCCCACTTCAAA
ARSFL11 F GCGAAGCATAACTGGCAGTATCTG [HEX]
R GCGGGCCTAGGTGATCTTGGA
2 EMFv104 F TGGAAACATTCTTACATAGCCAAA [6-FAM]
R CAGACGAGTCCTTCATGTGC
EMFn181 F CCAAATTCAAATTCCTCTTTCC [HEX]
R GCCGAAAAACTCAAACTACCC
EMFn121 F GGTCCCTAAGTCCATCATGC [6-FAM]
R GAGTGGATGCAAACATGAGC
3 EMFvi136 F GAGCCTGCTACGCTTTTCTATG [6-FAM]
R CCTCTGATTCGATGATTTGCT
EMFn170 F CAGTTTGCCCAACAACAAGG [HEX]
R TTGATGGCAACAAATCACG
EMFn111F F GAAGCTCCTCTCACAAAGTTAAGG [6-FAM]
R TCAACAACAACATCAACAAAGG

F: Forward; R: Reverse.

Análisis de fragmentos

Los productos de PCR se analizaron mediante electroforesis capilar en un secuenciador automático de ADN (ABI PRISM® 3100 Genetic Analyzer, Applied Biosystems, Foster City, CA, USA), se utilizó Liz-500 como marcador estándar interno de peso molecular; se usó un factor de dilución de cinco al momento de cargar los productos de PCR en el secuenciador. La lectura de los electroferogramas e identificación de alelos se realizó con el programa GeneMapper® versión 4.

Análisis de la información

Se construyeron patrones alélicos a partir de los cuales se identificaron las diferencias en número, tamaño e intervalo de amplificación para cada marcador. Posteriormente, con las frecuencias alélicas, calculadas a partir de la matriz binaria de presencia y ausencia elaborada con el paquete en Polysat bajo el ambiente R (Clark y Jasieniuk, 2011, 563), se compararon las similitudes o diferencias de los patrones alelicos expresados en cada una de las variedades; para ello se usó el programa de análisis de datos INFOGEN/E, v. 2014, a partir de ello se obtuvo la matriz de distancias con dos coeficientes distintos, el de Jaccard (Sj) (Sneath y Sokal, 1973, 121) y el de Dice (SD) (Dice, 1945, 297). Estos coeficientes expresan la probabilidad de que un alelo en un individuo se encuentre también en otro individuo (Lim et al., 2017, 230). A partir de estos coeficientes se construyeron fenogramas con el programa NTSYSpc v. 2.10.

Como estimadores poblacionales, se calcularon los siguientes índices:

  • Índice de uniformidad de una población U j = 1 m i = 1 m p i j , donde:

    • Uj = índice de uniformidad de la población j

    • Pij = frecuencia de la banda i en la población j

    • m = número de bandas analizadas

      Uniformidad máxima U = 1 ó U = 0; mínima U = 0.5

  • Índice de Shannon de diversidad de una población H j = - i = 1 m p i j ln p i j ,donde:

    • Hj = índice de Shannon de diversidad de una población

    • m = número de bandas considerado

    • Pij = frecuencia de la banda i en la población j

      Su valor mínimo es cero y se hace mayor al aumentar la diversidad.

  • Polimorfismo de la población media H p o p = 1 n j = 1 n H j , donde:

    • Hpop = polimorfismo de la población media

    • n = número de poblaciones

    • Hj = índice de Shannon de diversidad de la población j

  • Polimorfismo de la especie H s p = - i = 1 m p i   l n   p i , donde:

    • Hsp = polimorfismo de la especie

    • pi = frecuencia de la banda i en la especie

    • m = número de bandas considerado

Resultados

Amplificación de los marcadores SSR

Todos los marcadores usados se amplificaron vía PCR; además, el tamaño y número de las amplificaciones fueron consistentes con estudios previos que se pueden observar en el Cuadro 2, donde se presenta el número de picos, la temperatura de alineamiento para cada marcador y su tamaño expresado en pares de bases; donde se destaca que el peso molecular de los fragmentos amplificados se mantuvo dentro de los límites reportados por Govan et al. (2008, 653) y Brunings et al. (2010, 92).

Temperaturas de alineamiento, picos observados y tamaño de los fragmentos encontrados en el presente estudio en comparación con estudios previos
Locus -------Este estudio------ Brunings et al . (2010) Govan et al . (2008)
Ta PO Rango PO Rango PO Rango
(°C) (Pb) (Pb) (Pb)
ARSFL11 61.5 5 250 - 275 8 258-278 14 257-321
EMFN111 61.5 3 230 - 250 - - 24 208-269
EMFn121 51.5 5 225 - 260 8 228-254 15 226-256
EMFn170 58.0 9 185 - 230 9 188-233 15 188-238
EMFn181 54.6 11 155 - 240 7 164-212 35 138-248
EMFn182 59.8 5 170 - 210 8 179-202 15 191-219
EMFv104 58.6 12 75 - 135 15 72-126 27 69-138
EMFvi136 59.8 7 130 - 170 8 132-160 18 111-188
EMFvi166 59.8 4 255 - 285 4 268-281 11 254-282

Ta: Temperatura de alineamiento; PO: Picos observados; Pb: Pares de bases

El número de alelos observados es diferente en comparación con lo reportado por otros autores, debido a la cantidad y naturaleza de las variedades evaluadas, ya que la riqueza alélica de los marcadores SSR está influenciada por el número de poblaciones que se analicen (Yoon et al. 2012, 5). Se determinaron 63 alelos diferentes en las cinco variedades estudiadas (Cuadro 3). Con los nueve marcadores, el número de alelos amplificados estuvo entre 3 y 12 por marcador. Los marcadores que más alelos amplificaron fueron el EMFn181 y el EMFv104, con 11 y 12, respectivamente. De acuerdo con Govan et al. (2008, 658) y Kim et al. (2019, 111) tan sólo uno de estos dos SSR puede discriminar entre variedades muy relacionadas. Todos los marcadores evaluados tuvieron un alto nivel de variabilidad y están distribuidos por todo el genoma del género Fragaria, lo que resultó en una huella única para cada variedad.

Número de alelos observados y peso molecular expresados en pares de bases en los marcadores probados considerando las cinco variedades de fresa estudiadas
Marcadores Número de alelos observados
A1 A2 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12
ARSFL11 261 263 267 259 272
EMFn182 176 185 188 198 190 191
EMFvi166 278 271 278 269 260
EMFn121 229 233 254 255 248
EMFn181 166 172 175 185 188 211 218 231 159 209 236
EMFv104 78 88 91 104 108 112 123 125 128 95 110 117
EMFN111 244 247 236
EMFN170 187 193 197 201 208 223 225 216 205
EMFvi136 134 143 153 155 161 163 157

Alelos identificados; Este valor corresponde al peso molecular de cada alelo expresado en pares de bases (Pb)

Huella genética

Con los pesos moleculares de cada alelo, expresados en pares de bases (Pb), se crearon geles virtuales de las variedades por cada SSR (Figuras 1 y 2). En los cuales se observan claramente las diferencias entre variedades en cuanto al tamaño y número de fragmentos amplificados; esta información sirve como base estándar para comparar los resultados obtenidos en ensayos de identificación varietal del germoplasma. Las variedades CP0201 y CP0204, comparten a uno de sus progenitores, ambas provienen de la cruza de Camarosa por una selección avanzada del programa del Colegio de Postgraduados (SNICS, 2008a, 14; SNICS, 2008b, 14), por lo que están altamente emparentadas, situación que queda de manifiesto en su patrón alélico; sin embargo, es posible detectar diferencias entre ellas en los marcadores: EMFvi166 y EMFn181, estas se confirman con el análisis de similitud y el fenograma generado a partir de los datos moleculares.

Gel virtual con los patrones alélicos derivados de nueve loci de microsatélites SSR de las variedades CP0201 y CP0204, identificados mediante electroforesis capilar

Gel virtual con los patrones alélicos derivados de nueve loci de microsatélites SSR de las variedades CPLE7 y CP0615, identificados mediante electroforesis capilar

Las variedades CPLE7 y CP0615, (Figura 2), presentaron diferencias en cuanto al tamaño de los fragmentos encontrados, en los marcadores EMFn 121, EMFn181 y EMFN170, la presencia de alelos con diferentes pesos moleculares en un mismo locus se debe a la naturaleza codominante de los marcadores moleculares SSR y a la naturaleza octaploide de la fresa cultivada (Whitaker, 2011, 117; Kim et al., 2019, 111).

Brunings et al. (2010, 68) reportaron la huella genética de la variedad Festival de Florida, Estados Unidos, donde se analizó el mismo juego de marcadores moleculares, las diferencias con la variedad Festival mantenida en el Colegio de Postgraduados fueron las siguientes: cuatro marcadores (EMFvi166, EMFn121, EMFn170) tuvieron el mismo número de alelos; sin embargo, tres SSR (ARSFL11, EMFn182, EMFvi136) mostraron alelos distintos en tamaño de los fragmentos. El SSR EMFn181 tuvo nueve alelos contra cuatro en el trabajo previo y el SSR EMFv104 tuvo ocho alelos en comparación con seis del perfil de Florida (Figura 3).

Comparativos entre el patrón alélico de la variedad Festival mantenida en el Colegio de Postgraduados y la mantenida en Florida, según Brunings et al. (2010, 68)

Brunings et al. (2010, 71) y Lim et al., (2017, 230), encontraron en otras variedades más alelos con tamaños similares a los detectados en el presente estudio, lo que sugiere que la variedad Festival procedente del Colegio de Posgraduados tuvo un patrón alélico diferente al de la variedad mantenida en Florida; probablemente debido a contaminación en alguna de las etapas de incremento del material vegetal, posiblemente en vivero, lo anterior indica que es de gran importancia revisar cuidadosamente la metodología empleada en la multiplicación asexual de las colecciones de germoplasma en el programa de mejoramiento de fresa institucional.

Análisis de similitud

El análisis de similitud mostró que las variedades se diferenciaron en función de su origen, de tal manera que tanto para el coefiente de Jaccard como para el coeficiente de Dice se obtuvieron resultados similares cuando se calcularon las matrices de distancias fenéticas (Cuadro 4), los resultados de ambos se pueden observar en la Figura 4, donde se presentan los fenogramas que resultaron de cada uno de los coeficientes.

Matriz de similitud generadas a partir del conteo de alelos amplificados con microsatélites, obtenidos mediante los coeficientes de Jaccard y Dice
Variedad Jaccard
CP0201 CP0204 CP0615 CPLE7 Festival
CP0201 1.00
CP0204 0.88 1.00
CP0615 0.00 0.00 1.00
CPLE7 0.70 0.58 0.00 1.00
Festival 0.61 0.69 0.00 0.33 1.00
Variedad Dice
CP0201 CP0204 CP0615 CPLE7 Festival
CP0201 1.00
CP0204 0.94 1.00
CP0615 0.00 0.00 1.00
CPLE7 0.83 0.74 0.00 1.00
Festival 0.76 0.82 0.00 0.49 1.00

Fenogramas generados a partir de datos moleculares (SSR), resultado del cálculo de matrices de distancias fenéticas mediante el coeficiente de Dice (arriba) y de Jaccard (abajo)

El agrupamiento de las variedades fue la misma tanto al usar el coeficiente de Jaccard y el de Dice; CP0201 (Zamorana) y CP0204 (Jacona) tuvieron una huella genética similar y se situaron en la misma rama, así se confirmó su relación; los datos genealógicos de estas variedades indican que ambas comparten el mismo progenitor femenino (Rodríguez-Bautista et al., 2012, 115; SNICS, 2018, 9). Las variedades CP0615, CPLE7 y Festival poseen un patrón alélico distinto en comparación con las variedades CP0201 y CP0204. Lo anterior ratifica lo mencionado por Govan et al. (2008, 658) y Kim et al. (2019, 111) sobre el poder de discriminación de los microsatélites aquí empleados.

Estimadores poblacionales

En cuanto a los estimadores poblacionales calculados (Cuadro 5), el índice de uniformidad de una población (Uj), indica la distribución de cada uno de los alelos evaluados dentro de cada población, puede tomar valores de uniformidad máxima (Uj= 0 ó Uj= 1) o uniformidad mínima (0 < Uj < 1). El estimador Uj alimentado con los alelos derivados de los SSRs tuvo un nivel de uniformidad mínimo, debido a la naturaleza polimórfica de los microsatélites; el que más alelos presentó fue de nueve alelos de distintos tamaños; dado que el número de alelos amplificados por cada microsatélite cambia en función de las variedades, entonces la uniformidad entre poblaciones indicó que existieron diferencias entre los alelos observados.

Estimadores poblacionales de las variedades de fresa evaluadas
Variedad Uj Hj Hpop Hsp
CP0615 0.54 3.96 4.89 24.45
CP0201 0.46 5.10
CP0204 0.50 4.32
CPLE7 0.53 5.15
Festival 0.49 5.93

Uj : Índice de uniformidad de una población; Hj : Índice de diversidad de una población; Hpop: Polimorfismo de la población media; Hsp: Polimorfismo de la especie

En lo referente al índice de diversidad de una población (Hj), éste mide el grado de entropía o grado promedio de incertidumbre en identificar la categoría a que puede pertenecer un individuo elegido al azar de la colección. De esta manera, las variedades que tuvieron mayor diversidad alélica fueron Festival, CPLE7 y CP0201 (Zamorana), con respecto a las otras variedades consideradas en el estudio. En el Cuadro 5 se observa también el polimorfismo de la población media y el polimorfismo de la especie, dentro del espectro de las poblaciones analizadas.

Conclusión

Se obtuvo el patrón alélico o huella genética de cuatro variedades de fresa del Colegio de Postgraduados. Las diferencias entre variedades se expresaron en el número de alelos amplificados, así como en el tamaño de fragmentos. Se evidenciaron las similitudes entre las variedades CP0201 y CP0204, indicando su parentesco ya que comparten el progenitor femenino. Las variedades CP0615 y CPLE7 tienen un patrón alélico diferente a las demás variedades evaluadas.

Referencias
  • Amom, T., & Nongdam, P. (2017). The Use of Molecular Marker Methods in Plants: A Review. International Journal of Current Research and Review. 9(17):1-7. DOI: 10.7324/IJCRR.2017.9171
  • Arnau, G., Lallemand J. and Bourgoin M. (2001). Are AFLP markers the best alternative for cultivar identification. Acta Horticulturae 546:301-306. DOI: 10.17660/ActaHortic.2001.546.37
  • Arnau, G., Lallemand J. and Bourgoin M. (2002). Fast and reliable strawberry cultivar identification using inter simple sequence repeat (ISSR) amplification. Euphytica 129(1):69-79. doi: 10.1023/A:1021509206584.
  • Ather-uz-Zaman., Al-Khayri J. M., Islam R. (2018). Genetic Improvement of Strawberry (Fragaria ×ananassa Duchesne). In: Al-Khayri J., Jain S., Johnson D. (eds) Advances in Plant Breeding Strategies: Fruits. Springer, Cham. https://doi.org/10.1007/978-3-319-91944-7_6
  • Beovides, Y., Fregene M, Alves A, Gutiérrez J. P, Buitrago C, Marin A. J, Milián M. D, Rodríguez S, Cruz J. A, Ruiz E, Guerra D, Toledo H, Roca O, Albert J, García J, y Oliva M. (2006). Análisis de diversidad genética mediante microsatélites (SSR) en cultivares del germoplasma cubano de yuca. Biotecnología Vegetal 6(1):9-14. http://132.248.9.34/hevila/Biotecnologiavegetal/2006/vol6/no1/2.pdf
  • Brunings, A. M., Moyer C, Peres N, and Folta K. M.(2010). Implementation of simple sequence repeat markers to genotype Florida strawberry varieties. Euphytica 173(1):63-75. doi: 10.1007/s10681-0090112-4.
  • Carbone, F., Mourgues F, Biasioli F, Gasperi F, Märk T. D, Rosati C, and Perrotta G. (2006). Development of molecular and biochemical tools to investigate fruit quality traits in strawberry elite genotypes. Molecular Breeding 18(2):127-142. doi: 10.1007/s11032-006-9017-2.
  • Carrasco, B., Garcés M, Rojas P, Saud G, Herrera R, Retamales J. B, and Caligari P. D. S. (2007). The Chilean strawberry [Fragaria chiloensis (L.) Duch.]: genetic diversity and structure. Journal of the American Society for Horticultural Science 132(4):501-506. DOI: 10.21273/JASHS.132.4.501
  • Carrasco, B. , Retamales J. B , Quiroz K, Garriga M, Caligari P. D. S, García-Gonzales R. (2013). Inter Simple Sequence Repeat Markers Associated with Flowering Time Duration in the Chilean Strawberry (Fragaria chiloensis). Journal of Agricultural Sciences and Tecnology 15(6): 1195-1207. http://jast-old.modares.ac.ir/article_5032.html
  • Clark, L.V., and Jasieniuk M. (2011). POLYSAT: an R package for polyploid microsatellite analysis. Molecular Ecology Resources 11(3):562-566. doi: 10.1111/j.1755-0998.2011.02985.x.
  • Congiu, L., Chicca M, Cella R, Rossi R, and Bernacchia G. (2000). The use of random amplified polymorphic DNA (RAPD) markers to identify strawberry varieties: a forensic application. Molecular Ecology 9(2):229-232. https://doi.org/10.1046/j.1365-294x.2000.00811.x
  • Dangl, G. S., Lee E. W, Sim S. T, and Golino D. A. (2007). A new system for strawberry cultivar identification developed at Foundation Plant Services (FPS), University of California, Davis, using simple sequence repeat (SSR) primers. NASS/NASGA Proceedings, p. 118-121. http://fpms.ucdavis.edu/WebSitePDFs/Articles/Straw%20DNA%20ID118-121.pdf
  • Debnath, S. C., Khanizadeh S, Jamieson A. R, and Kempler C. (2008). Inter simple sequence repeat (ISSR) markers to assess genetic diversity and relatedness within strawberry genotypes. Canadian Journal of Plant Science 88(2):313-322. doi: 10.4141/CJPS07088.
  • Debnath, S. C. and Ricard E. (2009). ISSR, anthocyanin content and antioxidant activity analyses to characterize strawberry genotypes. Journal of Applied Horticulture 11(2):83-89. http://horticultureresearch.net/journal_pdf/200983-89.pdf
  • Debnath, S. C. (2014). Structured diversity using EST-PCR and EST-SSR markers in a set of wild blueberry clones and cultivars. Biochemical Systematics and Ecology. 54(1):337-347. https://doi.org/10.1016/j.bse.2014.03.018.
  • Degani, C., Rowland L. J, Saunders J. A, Hokanson S. C, Ogden E. L, Golan-Goldhirsh A, and Galletta G. J. (2001). A comparison of genetic relationship measures in strawberry (Fragaria × ananassa Duch.) based on AFLPs, RAPDs, and pedigree data. Euphytica 117(1):1-12. doi:10.1023/A:1004008408435.
  • Degani, C. , Rowland L. J , Levi A, Hortynski J. A, and Galleta G. J. (1998). DNA fingerprinting of strawberry (Fragaria × ananassa) cultivars using randomly amplified polymorphic DNA (RAPD) markers. Euphytica 102(2):247-253. DOI: 10.1023/A:1018385715007
  • Dice, L.R. (1945). Measures of the amount of ecologic association between species. Ecology 26(3): 297-302. https://doi.org/10.2307/1932409
  • Firas, R. S., y Abdulkareem A. 2015. Molecular markers: An introduction and applications. Eur. J. Mol. Biotechnol. 9(3):118-130. DOI: 10.13187/ejmb.2015.9.118
  • Folta, K. M., Clancy M. A, Chamala S, Brunings A. M, Dhingra A, Gomide L, Kulathinal R. J, Peres N, Davis K. M, Barbazuk W. B. (2010). A transcript accounting from diverse tissues of a cultivated strawberry. The Plant Genome 3(2):90-105. doi: 10.3835/plantgenome2010.02.0003.
  • Garcia, M. G., Ontivero M, Diaz Rici J.C, Castagnaro A. (2002). Morphological traits and high resolution RAPD markers for the identification of the main strawberry varieties cultivated in Argentina. Plant Breeding 121(1):76-80. https://doi.org/10.1046/j.1439-0523.2002.00671.x
  • Gil-Ariza, D. J., Amaya I, López-Aranda J.M, Sánchez-Sevilla J. F, Botella M.Á, Valpuesta V. (2009). Impact of plant breeding on the genetic diversity of cultivated strawberry as revealed by expressed sequence tag-derived simple sequence repeat markers. Journal of the American Society for Horticultural Science 134(3): 337-347. DOI: 10.21273/JASHS.134.3.337
  • González, A. y Aguirre X. (2007). Inter simple sequence repeats (ISSRs). En Ecología Molecular. Compilado por Luis Eguiarte, Valeria Souza y Xitlali Aguirre, 567-571. Secretaría de Medio Ambiente y Recursos Naturales, Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. México, D.F. https://www.researchgate.net/file.PostFileLoader.html?id=552c1fb0d3df3ee7548b458a&assetKe y=AS%3A273756348452864%401442280007420
  • Govan, C. L., Simpson D. W, Johnson A.W, Tobutt K. R, Sargent D. J. (2008). A reliable multiplexed microsatellite set for genotyping Fragaria and its use in a survey of 60 F. × ananassa cultivars. Molecular Breeding 22(4):649-661. doi: 10.1007/s11032-008-9206-2.
  • Graham, J., McNicol R. J, and McNicol J. W. (1996). A comparison of methods for the estimation of genetic diversity in strawberry cultivars. Theoretical and Applied Genetics 93(3):402-406. doi: 10.1007/BF00223182.
  • Hadonou, A. M., Sargent D. J, Wilson F, James C. M, Simpson D. W . (2004). Development of microsatellite markers in Fragaria, their use in genetic diversity analysis, and their potential for genetic linkage mapping. Genome 47(3):429-438. DOI: 10.1139/g03-142
  • Han, Z., Wang C, Song X, Guo W, Gou J, Li C, Chen X, Zhang T. (2006). Characteristics, development and mapping of Gossypium hirsutum derived EST-SSRs in allotetraploid cotton. Theoretical and Applied Genetics 112 (3):430-439. doi: 10.1007/s00122-005-0142-9.
  • Hancock, James. (2008). Temperate fruit crop breeding: Germplasm to genomics. Springer. http://link.springer.com/chapter/10.1007/978-1-4020-6907-9_13
  • Hilmarsson, H. S., Hytönen, T, Isobe, S, Göransson, M, Toivainen, T, Hallsson, J. H. (2017). Population genetic analysis of a global collection of Fragaria vesca using microsatellite markers. PloS one, 12(8):1-17. doi:10.1371/journal.pone.0183384
  • Holleley, C. E., and Geerts P. G. (2009) Multiplex Manager 1.0: a cross-platform computer program that plans and optimizes multiplex PCR. BioTechniques 46(7):511-517. doi: 10.2144/000113156.
  • Holton, T. A., Christopher J. T, McClure L, Harker N, Henry R. J. (2002). Identification and mapping of polymorphic SSR markers from expressed gene sequences of barley and wheat. Molecular Breeding 9(2):63-71. doi: 10.1023/A:1026785207878.
  • Hummer, K. (2007). Global conservation strategy for Fragaria(strawberry). Scientia Horticulturae 6. International Society for Horticultural Science, Leuven, Belgium. https://www.ishs.org/scriptahorticulturae/global-conservation-strategy-fragaria-strawberry
  • Hussein, T. S., Tawfik A. A, and Khalifa M. A. (2008). Molecular identification and genetic relationships of six strawberry varieties using ISSR markers. International Journal of Agriculture and Biology 10(6):677-680. http://www.fspublishers.org/published_papers/77379_..pdf
  • Hwang, J., Kang J, Son B, Kim K, and Park Y. (2011). Genetic diversity in watermelon cultivars and related species based on AFLPs and EST-SSRs. Notulae Botanicae Horti Agrobotanici Cluj-Napoca 39(2):285-292. http://dx.doi.org/10.15835/nbha3926382
  • Invitrogene. 2006. ChargeSwitch® gDNA Plant Kit for Purification of Genomic DNA (gDNA) from Plant Samples. p. 24. Version C. User Manual. Carlsbad, CA, USA. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/chargeswitch_plant_man.pdf
  • Kim, J., Lee, S.Y., Kim, D. Eun-Su L, Hye-Eun L, Koen H, Byoung-Cheorl K. (2019). Genotyping of octoploid strawberry inbred lines by SNP discovery using genotyping-by-sequencing. Horticulture, Environment, and Biotechnology. 60(1): 69-80. https://doi.org/10.1007/s13580-018-0100-5
  • Kim, H.J., Lee J.N, Soo Cho K.S, Sik Won H, Taek Suh J. (2019). Genetic Diversity and Population Structure Analysis of Ever-Bearing and June-Bearing Strawberry Cultivars Using SSR Markers. Horticultural Science and Technology. 37(1): 108-118. https://doi.org/10.12972/kjhst.20190010
  • Lim, S., Jeongyeo L, Hyun Joo L, Kun-Hyang P, Dae-Soo K, Sung Ran M, Won Seok J, Tae II K, HyeRan K. (2017). The genetic diversity among strawberry breeding resources based on SSRs. Scientia Agricola, 74(3): 226-234. https://dx.doi.org/10.1590/1678-992x-2016-0046
  • Melese L. (2018). Marker Assisted Selection in Comparison to Conventional Plant Breeding: Review Article. Agri Res & Tech: Open Access J. 14(2): 1- 10. DOI: 10.19080/ARTOAJ.2018.14.555914
  • Muhammad, A. N., Muhammad A. N, Muhammad Q. S, Yıldız D, Gonul C, Mehtap Y, Rüştü H, Fiaz A, Ahmad A, Nitin L, Hakan Ö, Gyuhwa C, Faheem S. B. (2018). DNA molecular markers in plant breeding: current status and recent advancements in genomic selection and genome editing, Biotechnology & Biotechnological Equipment, 32:2, 261-285, DOI: 10.1080/13102818.2017.1400401.
  • Nantoumé, A. D., Andersen S. B, Jensen B. D. (2013). Genetic differentiation of watermelon landrace types in Mali revealed by microsatellite (SSR) markers. Genetic Resources and Crop Evolution 60(7):2129-2141. doi: 10.1007/s10722-013-9980-5.
  • Novo, M., Romo S, Rey M, Prado M. J, González M. V. (2010). Identification and sequence characterisation of molecular markers polymorphic between male kiwifruit (Actinidia chinensis var. deliciosa (A. Chev.) A. Chev.) accessions exhibiting different flowering time. Euphytica 175(1):109-121. doi: 10.1007/s10681-010-0192-1.
  • Nunes, C. F., Ferreira J. L, Fernandes M. C. N, Breves S. S, Leal G. A, Soares B. D. F, Dias M. S. C, Pasqual M, Borem A, Cançado G. M. A. (2011). An improved method for genomic DNA extraction from strawberry leaves. Ciência Rural 41(8):1383-1389. http://dx.doi.org/10.1590/S0103-84782011000800014
  • Nunes, C. Ferreira., Ferreira J. L, Generoso A. L, Dias M. S, Carvalho P. M, Cançado G. M. de A. (2013). The genetic diversity of strawberry (Fragaria ananassa Duch.) hybrids based on ISSR markers. Acta Scientiarum. Agronomy, 35(4), 443-452. https://dx.doi.org/10.4025/actasciagron.v35i4.16737
  • Powell, W., Morgante M, Andre C, Hanafey M, Vogel J, Tingey S, Rafalski A. (1996). The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2(3):225-238. doi: 10.1007/BF00564200.
  • Rodríguez-Bautista, G., Calderón-Zavala G. Jaen-Contreras David, Curiel-Rodríguez A. (2012). Capacidad de propagación y calidad de planta de variedades mexicanas y extranjeras de fresa. Revista Chapingo Serie Horticultura, 18(1): 113-123. https://www.redalyc.org/articulo.oa?id=60923315008
  • Rousseau-Gueutin, M., Lerceteau-Köhler E, Barrot L, Sargent D. J , Monfort A, Simpson D, Arús P, Guérin G, Denoyes-Rothan B. (2008). Comparative genetic mapping between octoploid and diploid Fragaria species reveals a high level of colinearity between their genomes and the essentially disomic behavior of the cultivated octoploid strawberry. Genetics 179(4):2045-2060. doi: 10.1534/genetics.107.083840.
  • Sánchez-Sevilla, J.F, Horvath A, Botella M.A, Gaston A, Folta K, Kilian A, Denoyes B, Amaya I. (2015) Diversity Arrays Technology (DArT) Marker Platforms for Diversity Analysis and Linkage Mapping in a Complex Crop, the Octoploid Cultivated Strawberry (Fragaria × ananassa). Plos One 10(12):1-22. https://doi.org/10.1371/journal.pone.0144960
  • Sargent, D. J., Hadonou A. M, Simpson D. W. (2003). Development and characterization of polymorphic microsatellite markers from Fragaria viridis, a wild diploid strawberry. Molecular Ecology Notes 3(4):550-552. doi: 10.1046/j.1471-8286.2003.00507.x.
  • Sargent, D. J., Clarke J, Simpson D. W, Tobutt K. R, Arús P, Monfort A, Vilanova S, Denoyes-Rothan B, Rousseau M, Folta K. M, Bassil N. V, Battey N. H. (2006). An enhanced microsatellite map of diploid Fragaria. Theoretical and Applied Genetics 112(7):1349-1359. doi: 10.1007/s00122-0060237-y.
  • Sargent, D.J., Passey T, Šurbanovski N, Lopez E.G, Kuchta P, Davik J, Harrison R, Passey A, Whitehouse A. B, Simpson. (2012). A microsatellite linkage map for the cultivated strawberry (Fragaria × ananassa) suggests extensive regions of homozygosity in the genome that may have resulted from breeding and selection. Theoretical and Applied Genetics. 124(7): 1229-1240. https://doi.org/10.1007/s00122-011-1782-6
  • Shimomura, K. and Hirashima K. (2006). Development and characterization of simple sequence repeats (SSR) as markers to identify strawberry cultivars (Fragaria × ananassa Duch.) Journal of the Japanese Society for Horticultural Science 75(5):399-402. DOI: 10.2503/jjshs.75.399
  • Sneath, P.H.A. and Sokal R.R. (1973). Numerical taxonomy. The principles and practice of numerical classification. 573 p. W.H. Freeman and Company. San Francisco, CA, USA. https://www.jstor.org/stable/2412767
  • SNICS. (2008a). Guía técnica para la descripción varietal No. 0976, CP-02-04. Servicio Nacional de Inspección y Verificación de Semillas, SAGARPA. México.
  • SNICS. (2008b). Guía técnica para la descripción varietal No. 0975, CP-02-01. Servicio Nacional de Inspección y Verificación de Semillas, SAGARPA. México.
  • SNICS. (2018). Catálogo nacional de variedades vegetales, 3er trimestre. Servicio Nacional de Inspección y Verificación de Semillas, SAGARPA, México. https://www.gob.mx/cms/uploads/attachment/file/401833/CNVV3erTrim18_web_.pdf
  • Tyrka, M., Dziadczyk P, Hortyński J. A. (2002). Simplified AFLP procedure as a tool for identification of strawberry cultivars and advanced breeding lines. Euphytica 125(2):273-280. doi: 10.1023/A:1015892313900.
  • Whitaker, V. M. (2011). Applications of molecular markers in strawberry. Journal of Berry Research 1(3):115-127. doi: 10.3233/BR-2011-013.
  • Whitaker, V.M., Hashing T, Chandler C.K, Ploto A, Baldwin E. (2011). Historical trends in strawberry fruit quality revealed by a trial of University of Florida cultivars and advanced selections. HortScience 46(4): 553-57. https://gcrec.ifas.ufl.edu/static/docs/pdf/Historical_Retrospective.pdf
  • Yoon, M. Y., Moe K. T, Kim D.Y, Rho I. R, Kim S, Kim K. T, Won M K, Chung J W, Park Y. J. (2012). Genetic diversity and population structure analysis of strawberry (Fragaria × ananassa Duch.) using SSR markers. Electronic Journal of Biotechnology 15(2):1-16. doi: 10.2225/vol15-issue2-fulltext-5.
  • Zhang, L., Li Z, Wang Y, Jiang Z, Wang S, Huang H. (2010). Vitamin C, flower color and ploidy variation of hybrids from a ploidy-unbalanced Actinidia interspecific cross and SSR characterization. Euphytica 175(1):133-143. doi: 10.1007/s10681-010-0194-z.
Historial:
  • » Recibido: 11/01/2019
  • » Aceptado: 19/03/2019
  • » Publición digital: 2019May-Oct

Refbacks

  • There are currently no refbacks.


Copyright (c) 2019 Nova Scientia

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

Scope

Nova Scientia is a multidisciplinary, electronic publication that publishes biannually in the months of May and November; it is published by the Universidad De La Salle Bajío and aims to distribute unpublished and original papers from the different scientific disciplines written by national and international researchers and academics. It does not publish reviews, bibliographical revisions, or professional applications.

Nova Scientia, year 11, issue 22, May – October 2019, is a biannual journal printed by the Universidad De La Salle Bajío, with its address: Av. Universidad 602, Col. Lomas del Campestre, C. P. 37150, León, Gto. México. Phone: (52) 477 214 3900, http://novascientia.delasalle.edu.mx/. Chief editor: Ph.D. Ramiro Rico Martínez. ISSN 2007 - 0705. Copyright for exclusive use No. 04-2008-092518225500/102, Diffusion rights via computer net 04 - 2008 – 121011584800-203 both granted by the Instituto Nacional del Derecho de Autor.

Editor responsible for updating this issue: Direction of Research Department of the Universidad De La Salle Bajío, last updated on May 28th, 2019.