Influencia de fuentes de fosfato inorgánico en la expresión de proteínas de una cepa bacteriana solubilizadora de fosfato nativa de La Comarca Lagunera
Resumen
Introducción

El presente trabajo tuvo como objetivo identificar las proteínas implicadas en la solubilizacion de fosfatos inorgánicos (Pi) en Klebsiella aerogenes y evaluar la capacidad de solubilizacion de Pi bajo la influencia de fuentes de carbono (C) y nitrógeno (N) en bacterias aisladas de la Comarca Lagunera.

Método

Se trabajó con ocho cepas bacterianas aisladas de cultivos forrajeros de La Comarca Lagunera y conservadas en glicerol a -20 °C. Se determinó el Índice de Solubilización (IS) en medio sólido Pikovskaya (PVK) y se cuantificó la solubilización de Pi en medio líquido con diferentes fuentes de C, N y fósforo (P). Se realizó una identificación molecular de la cepa que presentó la mayor capacidad para solubilizar el Pi. Para los estudios de expresión de proteínas, se realizaron cultivos bacterianos por duplicado con dos diferentes fuentes de Pi {(fosfato de calcio (FC) y fosfato de aluminio (FA)} en medio líquido PVK. Se llevó a cabo una precipitación de proteínas con ácido tricloroacético (TCA) y una cuantificación con BCATM Protein assay kit. Las proteínas se corrieron en gel de poliacrilamida al 12%, se realizó una digestión con la enzima tripsina y se analizaron los péptidos obtenidos por HPLC-espectrometría de masas. La identificación de la función de las proteínas se llevó a cabo mediante el uso de herramientas bioinformáticas.

Resultados

K. aerogenes fue la bacteria que presentó una mayor capacidad para solubilizar FC (2.31 y 2.59) en medio sólido PVK Glucosa (G)-Urea (U) y G- Nitrato de Amonio (NA) respectivamente, FC (1.97 ppm) y FA (1.36 ppm) en medio líquido PVK U-G. En los cultivos bacterianos se identificaron doscientas dieciséis proteínas entre las cuales se encontraron: ABC transportadoras, histidina quinasa Pho, proteína del sistema de transporte específico de fosfato Pho U, involucradas con el aprovechamiento del P.

Discusión o Conclusión

Las fuentes de C y N influyen en la capacidad de solubilización de Pi en bacterias nativas de La Comarca Lagunera. Los mejores resultados de solubilización se presentaron cuando la G se encontraba en el medio como fuente de C y la U como fuente de N. Bajo las condiciones de experimentación, no se observaron proteínas únicas de K. aerogenes para solubilizar el FC y FA. Se observó únicamente diferencias en el nivel de expresión de algunas proteínas identificadas.

Abstract
Introduction

The aim of this work was to identify the proteins involved in solubilization of inorganic phosphates (Pi) of Klebsiella aerogenes and to evaluate the solubilization capacity of Pi under the influence of different carbon (C) and nitrogen (N) sources of bacteria isolated from La Comarca Lagunera.

Method

Eihgt strains, isolated from La Comarca Lagunera forage crops and conserved in glycerol at -20° C, were used. The Solubilization Index (SI) was determined in solid medium PVK and the solubilization of Pi was quantified in liquid medium with different C, N and Phosphorus (P) sources. Bacteria with highest capacity to solubilize phosphate was identified by molecular methods. For protein expression studies, bacterial cultures were done by duplicate in two Pi sources {(calcium phosphate (CP) and aluminum phosphate (AP)} using PVK liquid medium. Proteins were precipitated with trichloroacetic acid (TCA), quantified with BCATM Protein assay kit and run on 12 % polyacrylamide gel. A tryptic digestion was done and the peptides obtained were analyzed by HPLC-mass spectrometry. Proteins and their function were identified with bioinformatic tools.

Results

K. aerogenes showed the greatest capacity to solubilize CP (2.31 y 2.59) in solid medium PVK with Glucose (G)-Urea (U), G-Ammonium Nitrate (AN) respectively, CP (1.97 ppm) and AP (1.36 ppm) in PVK liquid medium with G-U. Two hundred sixteen proteins were identified in both bacterial cultures, among which were found ABC transporter, Pho kinase histidine and Phosphate-specific transport system accessory protein Pho U, involved with the use of P.

Discussion or Conclusion

The sources of C y N influence the solubilization capacity of Pi in native bacteria from La Comarca Lagunera. The best solubilization results were found when G and U were in the medium as source of C and N respectively. Under the conditions in this study, K. aerogenes did not express unique proteins to solubilize FC and FA. The expression levels of some proteins were different in some identified proteins.

Palabras clave:
    • Klebsiella;
    • proteínas;
    • solubilización;
    • fosfato inorgánico.
Keywords:
    • Klebsiella;
    • proteins;
    • solubilization;
    • inorganic phosphate.

Introducción

El fósforo (P) es uno de los principales nutrientes que necesitan las plantas para su crecimiento. Generalmente, los suelos contienen altas cantidades de P inorgánico y orgánico; el primero corresponde a las hidroxiapatitas y fluoroapatitas, mientras que el segundo se encuentra como ácido fítico o fitato en los residuos animales y vegetales. Sin embargo, el P presente en los compuestos orgánicos no es aprovechado por las plantas (Mengel et al., 2001a). Los microorganismos juegan un papel importante en la solubilización del P. Algunas bacterias y hongos tienen la capacidad de producir enzimas, las cuales son las encargadas de liberar el ion ortofosfato del ácido fítico, compuesto soluble para la planta (Sharma et al., 2013). En el caso del fósforo inorgánico, algunos microorganismos producen y liberan ácidos orgánicos al suelo capaces de disolver el P mineral, como resultado del intercambio aniónico de fosfato por el anión ácido o pueden quelar iones de Fe3+, Al3+ y Ca2+ asociados con P (Omar, 1997). Actualmente, se ha logrado estudiar a fondo diversos mecanismos de solubilización de P. Se sabe que dichos mecanismos, en los cuales actúan los microorganismos, dependen de las limitaciones de nutrimentos que podrían llegar a presentarse y del estrés ambiental al que se sometan (Liu et al., 1992; Antelman et al., 2000).

Con las nuevas tecnologías como la proteómica, se puede identificar, caracterizar y determinar la función de las proteínas dentro de la célula y obtener un amplio panorama del funcionamiento de un microorganismo (Cahill et al., 2001).

En el presente trabajo se hace uso de la proteómica para identificar las proteínas implicadas en la solubilización de fosfatos inorgánicos por bacterias nativas de La Comarca Lagunera.

Método

Evaluación de fuentes de C y N para la solubilización de Pi en medio sólido PVK

Se trabajó con las cepas SP1, SP2, SP3, SP4, SP6, SP7, SP8 y SP9, aisladas previamente de cultivos forrajeros de La Comarca Lagunera (datos no publicados) y conservadas a -20 °C en glicerol al 25 %. Se preparó un inóculo con las cepas en caldo nutritivo a 30 °C, 150 rpm por 24 horas. Se usó el medio sólido Pikovskaya (PVK) con la siguiente composición en gramos por litro: glucosa, 10; Ca3(PO4)2, 5; (NH4)2SO4, 0.5; NaCl, 0.2; MgSO4·7H2O, 0.1; KCl, 0.2; extracto de levadura, 0.5; MnSO4·H2O, 0.002; FeSO4·7H2O, 0.002, agar bacteriológico, 15. Se utilizaron diferentes fuentes de C, N y Pi en este medio y se realizó un cálculo para tener la misma cantidad de estos elementos en los medios de cultivo, independientemente de su fuente (Tabla 1). El inóculo se ajustó a una densidad óptica de 0.5 a 600 nm y se inocularon 5 μL de éste en las cajas conteniendo el medio sólido PVK. Las cajas se incubaron a 30 °C por 72 horas, los ensayos se realizaron por triplicado. A los tres días se determinó el Indicé de Solubilización (IS) relacionando el diámetro total (colonia + el halo)/el diámetro de la colonia.

Fuentes de carbono, nitrógeno y fósforo utilizadas en el medio sólido PVK.
Carbono Nitrógeno Fósforo
Glucosa Nitrato de amonio Fosfato de calcio
Fructosa Urea Fosfato de aluminio
Sacarosa Sulfato de amonio

Evaluación de fuentes de C y N para la solubilización de Pi en medio líquido PVK

Los inóculos se prepararon bajo las condiciones descritas anteriormente, se utilizaron 5 mL para inocular matraces de 125 mL conteniendo 25 mL del medio líquido PVK con diferentes fuentes de C, N y P. Los cultivos se incubaron a 30 °C, 150 rpm por 72 horas, el ensayo se realizó por triplicado. Se determinó el contenido de fosfato soluble en medio líquido mediante la metodología reportada en la Norma NMX-AA-029-SCFI-2001.

Identificación molecular

Se realizó la amplificación de un fragmento de 400 pares de bases del gen 16S rDNA de una muestra de DNA extraído. Los primers utilizados fueron 16S f 5’ -AGGAGGTGATCCAACCGCA - 3’ y 16S r 5’ AACTGGAGGAAGGTGGGGAT - 3’. Se utilizaron 14.5 µL de agua destilada estéril, 3.5 µL de Buffer 10X/MgCl2 50 mM, 0.5 µL dNTP’s 10 mM, 2 µL primers f y r 10 mM, 0.5 µL de Taq polimerasa paq5000 (Agilent Technologies) y 2 µL de DNA 100 ng µL-1 para tener un volumen total de reacción de 25 µL. La reacción se llevó a cabo en termociclador Axigen Maxigen® bajo el siguiente programa: 1 ciclo de desnaturalización a 95 °C por 5 minutos, 35 ciclos de desnaturalización a 94 °C por 1 minuto, alineamiento a 54 °C por 1 minuto y elongación a 72 °C por 5 minutos y una temperatura final de 4 °C.

La secuenciación de los productos amplificados se realizó en un secuenciador automático (Perkin Elmer modelo 3730 Applied Biosystem®). Las secuencias obtenidas fueron alineadas y analizadas con la herramienta BLAST (Basic Logical Aligment Search Tool) de la base de datos National Center of Biotechnology Information (NCBI) del GenBank con secuencias altamente similares.

Estudios de expresión de proteínas en la cepa seleccionada

Cultivos bacterianos

Se realizaron cultivos de la cepa SP3 para estudiar la expresión de proteínas, esta cepa presentó mayor capacidad de solubilización de P inorgánico. Se preparó medio líquido PVK usando como fuente de C la glucosa, para el N urea y para P se utilizaron fosfato de calcio y fosfato de aluminio. El inóculo se preparó bajo las condiciones descritas anteriormente y se utilizaron 5 mL para inocular matraces de 250 mL conteniendo 70 mL del medio PVK. Los cultivos se realizaron por duplicado y se incubaron a 30 °C, 150 rpm por 72 horas. Se realizó la medición de pH al inicio y al final de la fermentación y se determinó la concentración de azúcares reductores por DNS.

Precipitación y cuantificación de proteína

La precipitación de proteínas se llevó a cabo con TCA al 100 %. A una muestra de 30 mL del cultivo bacteriano se le agregó el mismo volumen de TCA, la mezcla se homogenizó y se dejó precipitar toda la noche a -20 °C y después fue centrifugada a 10 000 rpm durante 15 min a 4 °C. El sobrenadante fue retirado para lavar la pastilla obtenida con 500µL de acetona fría (cuatro veces), se dejó secar la pastilla por 3 horas a 7°C y se resuspendió en 1 mL de buffer Tris-HCL pH 7 con 2% SDS.

Para la cuantificación de proteína se utilizó el BCATM Protein assay kit (Pierce®), con Albumina Bovina como estándar (SIGMA®).

Geles de poliacrilamida

Se cargaron 50 μg de proteína de cada una de las muestras en un gel de poliacrilamida al 12% ((Bolt 12% Bis-Tris Plus, Thermo Fisher Scientific®) y se realizó la electroforesis a 95 V. Los geles se tiñeron con Azul de Comassie y se lavaron con agua destilada.

Cada banda del gel se cortó en tres secciones iguales, cada sección se cortó en piezas de aproximadamente 1 mm y se pasaron a tubos Eppendorf, se destiñó el gel con una solución de metanol 50 %/ácido acético 5 %, se hicieron lavados cada 30 min hasta que los geles se destiñeron por completo.

In-gel Digestión de proteínas

Día 1. Lavados

Las muestras se lavaron con H2O destilada durante 5 minutos y se decantó el agua, se adicionaron 125 µL de solución 50/50 acetonitrilo (ACN) 60%/H2O para realizar un lavado por 5 minutos y retirar el reactivo. Este procedimiento se repitió una vez más. Se agregaron 125 µL de Ambic (bicarbonato de amonio al 100 mM) y se lavó por 5 min, después se adicionaron 125 µL de ACN (100%) y se lavó durante 5 min más, se retiraron ambas soluciones, se repitió el lavado con ACN, se retiró y se dejaron secando las muestras en una centrifuga de vacío.

Día 2. Alquilación y reducción

Se adicionaron 125 µL de DTT (1,4 Dithiothreitol 10 mM preparado en AMBIC) a las muestras y se incubaron a 65 °C por 1 hora. Las muestras se dejaron enfriar y se descartó la solución. Se agregaron 125 µL de IDA (iodoacetamida 55 mM preparado en AMBIC) y se incubó en la oscuridad por 1 hora y se decantó la solución.

Se realizó un lavado con 125 µL de Ambic por 5 min, y se adicionaron 125 µL de ACN (100%) por 5 min, se descartó la parte líquida y se dejaron secar las muestras en la centrifuga de vació toda la noche.

Digestión por enzima tripsina

Se preparó una solución de tripsina 20 µg/mL Ambic. Se agregó esta solución en una proporción de 50:1 (w/w proteína tripsina). Se adicionaron 50 µL y 100 µL de AMBIC para cubrir completamente los geles, se dejó incubar a 37 °C por 18 horas.

Día 3. Extracción de péptidos

Después de la incubación de los péptidos, se agregaron 150 µL de buffer de extracción {50% ACN, 50 % H2O, 0.1% ácido fólico (AF)}, se mezcló en el vórtex y se incubó por 10 min, se obtuvo el sobrenadante y se pasó a un tubo Eppendorf nuevo, este paso se realizó dos veces más y se dejaron secar las muestras toda la noche en la centrifuga de vacío. Las muestras se resuspendieron en 100 µL de buffer de extracción, se filtraron y se dejaron secar toda la noche en la centrifuga de vacío. Las muestras se almacenaron a -20 °C hasta su análisis.

Análisis por cromatografía líquida acoplada a espectrometría de masas

Los péptidos se resuspendieron en 19 µL del buffer A (ácido fórmico al 0.1 %) y 1 µL del buffer B (80 % de acetonitrilo y 0.1 % de ácido fórmico). Las muestras se pasaron a través de un filtro de 0.2 μm (Nanosep, Pall Corp®) antes de cargarse en un tubo de muestreador automático y se insertaron en un sistema Ultimate 3000 LC (Thermo Scientific - Dionex®). El análisis LC-MS/MS se realizó en un Orbitrap Fusion Tribrid (Thermo Scientific®) utilizando una fuente de ionización de nanopulverización. Para cada muestra, se inyectaron 6 µl y los péptidos se separaron mediante un gradiente de 90 minutos de buffer B creciente, a un caudal de aproximadamente 200 µL por minuto. Se recolectó el espectro de masa completo cada tres segundos, se fragmentaron continuamente los iones más intensos con 38 % de disociación inducida por colisión (CID) y se registraron los espectros MS/MS resultantes. La exclusión dinámica se utilizó para excluir iones precursores del proceso de selección durante 60 segundos después de una segunda selección dentro de una ventana de 10 segundos.

Búsqueda de bases de datos e identificación de proteína

Los espectros de masas tándem se convirtieron en archivos genéticos de Mascot, utilizando el procesador MSConvert (http://proteowizard.sourceforge.net/tools.shtml). Se realizaron búsquedas en los archivos MGF utilizando el programa Mascot (Matrix Scientific, Boston, MA). Para la identificación de proteínas, se utilizó una base de datos, en noviembre del 2017, del National Center for Biotechnology Information (NCBI) específica para K. aerogenes.

La base de datos reversa se generó invirtiendo todas las secuencias de las proteínas de la base de datos de destino, con la verificación de que todas las secuencias invertidas creadas no coincidieran con las secuencias presentes en la base de datos de destino. Los parámetros del Mascot fueron los siguientes: segmentaciones enzimáticas trípticas, que permiten hasta dos divisiones omitidas, tolerancia a péptidos de 20 ppm, tolerancia iónica a fragmentos de 0.8 Da, modificación fija debida a carboxiamidometilación de cisteína (+57 Da), modificaciones variables de oxidación de metionina (+16 Da) y desamidación de asparagina o glutamina (+0.98 Da). Se determinaron proteínas estadísticamente significativas para todas las muestras.

Anotación funcional de las proteínas

La búsqueda de la función de las proteínas se realizó en los sitios web http://pfam.xfam.org/ y http://www.uniprot.org/ utilizando los archivos fasta de la base de datos para K. aerogenes desarrollada en noviembre del 2017.

Análisis estadístico

Se realizó un ANOVA simple para comparar los resultados de la cuantificación del fosfato inorgánico solubilizado y el índice de solubilización de las cepas y en los casos donde hubo diferencia significativa se realizó una prueba de LSD de Fisher con un α=0.05. Se utilizó el programa Statgraphics centurión.

Resultados

Evaluación de fuentes de C y N para la solubilización de Pi en medio sólido PVK

Cuando la glucosa, la urea, el nitrato de amonio y el fosfato de calcio estaban presente en el medio de crecimiento como fuente C, N y P, se observó la presencia de halos de solubilización (Tabla 2). La cepa SP1 fue la única que no presentó halo de solubilización por lo que fue descartada, la cepa SP2 solo presentó halo en el medio de crecimiento enriquecido con urea y glucosa (Figura 1). El ANOVA donde se compararon cepas y medios de crecimiento, arrojó que para ambos factores hubo diferencia significativa (Figura 2).

Índice de solubilización (IS) en medio sólido PVK. La expresión NA aplica donde no hubo formación de halos de solubilización. ANOVA y prueba LSD de Fisher con un α=0.05.
Cepa Índice de solubilización
Urea y glucosa Nitrato de amonio y glucosa
SP1 NA NA
SP2 1.39c NA
SP3 2.31a 2.59a
SP4 1.75b 2.13a
SP6 1.19c 1.14c
SP7 1.32c 1.7b
SP8 1.7c 2.13a
SP9 1.83b 1.79b

Halos de solubilización de fosfato de calcio en medio sólido. 1A. Medio con fuente de C-N glucosa y urea respectivamente. 1B. Medio con Fuente de C-N glucosa y NA respectivamente

Índice de solubilización (IS) en medio sólido PVK. ANOVA y prueba LSD de Fisher con un α=0.05.

Evaluación de fuentes de C y N para la solubilización de Pi en medio líquido PVK

Para esta metodología solo se analizaron las cepas que presentaron mayor IS en medio sólido PVK, la cuales fueron la SP3 (2.31 y 2.59), SP4 (1.75 y 2.13), SP8 (1.7 y 2.13) y SP9 (1.83 y 1.79) en medios de crecimiento urea-glucosa-fosfato de calcio y nitrato de amonio-glucosa-fosfato de calcio, respectivamente.

Comparando los valores de solubilización arrojados en ambos tipos de fosfato, la cepa SP3 fue la que presentó hasta 1.97 ppm, siendo la mayor cantidad de fosfato de calcio solubilizada en el medio U+G, seguida de la SP9 con un valor de 1.88 ppm en dicho medio. En el caso del medio NA+G, la máxima solubilización de P se obtuvo con la cepa SP9, alcanzando un valor de 1.85 ppm, seguida de la cepa SP3 con un valor de 1.74 ppm. Para el FA nuevamente la cepa SP3 alcanzó el valor más alto con 1.36 ppm, seguida de la SP8 con 0.79 ppm en el medio U+G. Para el medio NA+G SP9 y SP8 obtuvieron valores de 0.94 ppm y 0.55 ppm respectivamente, siendo los valores más altos (Tabla 3).

Cuantificación del Pi solubilizado en medio líquido PVK. Glucosa (G) como fuente de C, urea (U) y nitrato de amonio (NA) como fuentes de N. ANOVA y prueba LSD de Fisher con un α=0.05.
Cepa Fosfato de calcio (ppm) Fosfato de aluminio (ppm)
U+G NA+G U+G NA+G
SP3 1.97a 1.74a 1.36b 0.53c
SP4 0.61c 0.23d 0.77c 0.20d
SP8 1.28b 1.00b 0.79c 0.55c
SP9 1.88a 1.85a 0.66c 0.94b

El ANOVA donde se compararon cepas y medios (Glucosa-Urea y Nitrato de amonio-Glucosa con fosfato de calcio y fosfato de aluminio arrojó que para ambos factores hubo diferencia significativa (Figura 3)

Solubilización de Pi en medio líquido PVK. ANOVA y prueba LSD de Fisher con un α=0.05.

Identificación molecular

Debido a sus altos valores de solubilización, la cepa SP3 fue seleccionada para su identificación molecular y posteriores estudios de proteómica. La comparación del fragmento de ADN, obtenido por PCR y secuenciado, con la base de datos del NCBI arrojo un valor positivo para la bacteria Klebsiella aerogenes (Figura 4)

Identificación molecular bacteriana.

Estudios de expresión de proteínas en la cepa seleccionada

Medición de pH y azúcares reductores en cultivos bacterianos

Se monitoreó el pH al principio y al final de los cultivos bacterianos (Tabla 4), se observa en ésta que en los medios que contenían FC no hubo un decremento significativo en el pH, caso contrario al medio que contenía FA como fuente de P, lo anterior se puede atribuir a una mayor presencia de ácidos orgánicos en el medio. Además se midieron azúcares reductores, se alcanzaron valores de hasta 96 y 95.5 % de consumo de glucosa para los cultivos en FA y FC respectivamente.

pH y azúcares reductores medidos en el cultivo bacteriano.
Muestra [Glu] (%) pH inicial pH final
FC 95.5 7.04 6.57
FA 96 7.07 3.21

Identificación y anotación funcional de proteínas

Se estudió la influencia de la fuente de P inorgánico en la expresión de proteínas en K. aerogenes, considerada como Bacteria Solubilizadora de Fosfato (BSF). El fosfato de calcio y fosfato de aluminio fueron las únicas fuentes en los cultivos bacterianos. Se lograron identificar un total de doscientos dieciséis proteínas. Bajo las condiciones de experimentación, no se detectaron proteínas únicas para los cultivos en FC o FA. La sobreexpresión de proteínas sólo se consideró cuando se obtuvieron valores mayores a 2. La tabla 5 muestra las proteínas identificadas involucradas en el aprovechamiento del P, como las ABC transportadores. Para este caso, no se observó un cambio de diferencia en la expresión mayor a 2. Además, se observó la presencia de la proteína histidina quinasa Pho y proteína del sistema de transporte específico de fosfato Pho U con un cambio de diferencia (fold) de 1.10 el cual no se considera significativo.

Proteínas ABC transportadoras transmembrana registradas y su abundancia en el cultivo celular. El incremento corresponde a la cantidad de veces que se encuentra la proteína en cada condición, se considera significativo si el cambio de diferencia es ›2 (2 fold). NA (no aplica) cuando se encuentra en la misma cantidad en ambas condiciones. Fosfato de calcio (FA) y Fosfato de Calcio (FC).
Nombre de la proteína Incremento Función Péptidos identificados
FA FC
Proteína de unión al sustrato del transportador ABC de galactosa 1.04 Transportar la galactosa a través de una bicapa lipídica 37
Proteína de unión al sustrato del transportador de oligopéptidos ABC OppA 1.16 Transporte transmembrana 35
Glutamato / aspartato ABC transportador sustrato proteína de unión NA NA Permite el movimiento dirigido de sustancias hacia dentro y/o fuera de la célula 28
Proteína de unión al sustrato del transportador ABC del aminoácido de cadena ramificada 1.70 Proteínas de unión periplasmáticas 20
Proteína de unión al sustrato transportadora de cistina ABC NA NA Catálisis de la transferencia transmembrana de un ion 26
Proteína transportadora de sustrato del transportador ABC 1.19 Proteínas de unión a soluto extracelulares 14
Spermidine / putrescine transportador de ABC proteína de unión al sustrato PotF 1.31 Proteínas de unión a soluto extracelulares 14
Proteína transportadora de sustrato del transportador ABC NA NA Transporte 21
Transportador de ABC de azúcar proteína de unión a ATP 1.2307 Dominio soluble en agua de transportadores ABC transmembrana 25
Proteína de unión al sustrato del transportador de histidina ABC HisJ 1.91 Transporte 10
D-ribosa ABC transportador sustrato-proteína de unión 1.58 Catálisis de la transferencia de un grupo fosfato 12
Transportador de Xylose ABC Proteína de unión a ATP NA NA Exportación o importación de sustratos que van desde iones pequeños hasta macromoléculas 14
Proteína de unión al sustrato del transportador de metionina ABC MetQ 1.11 Pueden estar involucrados en la virulencia bacteriana 9

Además, se lograron identificar proteínas que participan en rutas metabólicas de las cuales se obtiene la mayor producción de ácidos orgánicos, como se comentó con anterioridad estos ácidos orgánicos son uno de los principales mecanismos de solubilización de Pi que emplean las bacterias (Tabla 6).

Proteínas identificadas en los cultivos bacterianos que participan en rutas metabólicas.
Nombre de la proteína Función Incremento Péptidos identificados
F. A. F.C.
aldehído deshidrogenasa Glicólisis 1.07 33
subunidad grande de carbamoil fosfato sintasa Ciclo de la urea 1.06 45
malato deshidrogenasa Ciclo del ácido cítrico 1.13 13
complejo piruvato deshidrogenasa dihydrolipoyllysine-residuo acetiltransferasa Oxidación anaerobia del piruvato 1.17 24
piruvato oxidasa 1.04 31
fosfoglicerato quinasa Glucólisis 1.42 21
6-fosfofructoquinasa dependiente de ATP 1.21 21
succinato - subunidad beta CoA ligasa Ciclo de krebs 1.16 17
succinato - subunidad alfa de la CoA alfa 1.28 10
NAD (P) oxidorreductasa dependiente Ciclo de beta-oxidación. 1.05 9
beta-cetoacil-ACP reductasa ácidos grasos 1.3 7
clase II fructosa-bisfosfato aldolasa Glucólisis, gluconeogénesis y el ciclo de Calvin 1.2 13

Discusión y Conclusiones

La glucosa como única fuente de carbono en el medio de crecimiento, propició una mayor solubilización. Rubio et al., (2016) y Relwani, et al., (2008), estudiaron la influencia de las fuentes de C y N en la solubilización de fosfato de calcio en los hongos Talaromyces flavus (BAFC 3125) y Aspergillus tubingensis, respectivamente. Los primeros autores concluyen que la presencia de glucosa aumentó la producción de ácidos orgánicos, especialmente ácido glucónico, el cual es considerado uno de los principales ácidos solubilizadores de P. Relwani et al., (2008), reportaron que A. tubingensis fue capaz de degradar todas las fuentes de C, sin embargo, la glucosa y sacarosa promovieron significativamente la solubilización de P. Con respecto a la fuente de N, la urea arrojó valores altos de solubilización en el medio de crecimiento, caso contrario a lo observado por Rubio et al. (2016), quienes determinaron que los tratamientos que contenían NA y SA presentaban una mayor solubilización, así mismo lo reportaron Relwani et al., (2008), cuando el KNO3 se encontraba en el medio de crecimiento.

En el presente estudio se encontraron las proteínas ABC transportadoras transmembrana (Tabla 5) responsables de adquirir y transportar el fosfato. Pegos et al., (2014) reportaron la presencia de estas proteínas cuando la cepa Xanthomonas citri se encontraba bajo condiciones de estrés (falta de P). Se concluye que las proteínas ABC transportadoras pertenecen al sistema de privación del fosfato {phosphate starvation system (Pst)}, el cual es uno de los mecanismos que activan las bacterias para mantener el control de la homeostasis del fosfato, se activa cuando la bacteria se encuentra bajo estrés ambiental (falta de nutrimentos) o si el suelo contiene diversos tipos de fosfato (Rouached et al., 2010).

Además, se encontró la proteína histidina quinasa PhoR, la cual es uno de los dos componentes del sistema regulador del regulon Pho y desempeña un papel clave en la homeostasis del P. La función de dicha enzima es interactuar con el sistema de transporte específico de fosfato (proteínas ABC transportadoras) y una proteína llamada PhoU para detectar los niveles de P inorgánico ambiental (Lamarche, et al., 2008).

Se concluye que las fuentes de Carbono y Nitrógeno influyen en la capacidad de solubilización de fosfato inorgánico en bacterias nativas de La Comarca Lagunera. Los mejores resultados de solubilización en fosfato inorgánico se presentaron cuando la glucosa se encontraba en el medio como única fuente de carbono y la urea como fuente de nitrógeno. Se clasifica a las bacterias nativas de La Comarca Lagunera como bacterias solubilizadoras de fosfato porque mostraron tener la capacidad de solubilizar fosfato de calcio y aluminio. K. aerogenes resultó ser la cepa bacteriana que presentó una mayor capacidad para solubilizar fosfato de calcio (2.31 cm) en medio sólido PVK y fosfato de calcio (1.97 ppm) y fosfato de aluminio (1.36 ppm) en medio líquido PVK. Bajo las condiciones experimentales de este estudio, no se identificaron proteínas únicas de K. aerogenes para solubilizar el fosfato de calcio y fosfato de aluminio, la bacteria solo varió su nivel de expresión de proteínas en cada una de las condiciones estudiadas.

Agradecimientos

  • Los autores expresan sus agradecimientos al Consejo Nacional de Ciencia y Tecnología (CONACYT) por el otorgamiento de la beca a la estudiante Ana Sofía Flores Castellanos para cursar sus estudios de maestría.

Referencias
  • Anderson, S., Marks, C. B., Lazarus, R., Miller, J., Stafford, K., Seymour, S., Light, D., Rastetter, W., y Estell, D. (1985). Production of 2-keto-L-gluconate, an intermediate in L-ascorbate synthesis, by a genetically modified Erwinia herbicola. Science. 230: 144-149
  • Antelmann, H., Scharf, C., Hecker, M. (2000). Phosphate starvation-inducible proteins of Bacillus subtilis: proteomics and transcriptional analysis. Journal of bacteriology. 182(16): 4478-4490
  • Bano, N., Musarrat, J. (2003). Isolation and characterization of phorate degrading soil bacteria of environmental and agronomic significance. Lett. Appl. Microbiol. 36: 349-353
  • Cahill, D. J., Nordhoff, E., O’Brien, J., Klose, J., Eickhoff, H., Lehrach, H. (2001). Bridging genomics and proteomics. Proteomics: from protein sequence to function. BIOS Scientific Publishers, New York, pp. 1-22
  • Goldstein, A. H. (1995). Recent progress in understanding the molecular genetics and biochemistry of calcium phosphate solubilization by Gram negative bacteria. Biol. Agric. Hort. 12: 185-193
  • Goldstein, A.H., Liu, S. T. (1987). Molecular cloning and regulation of amineral phosphate solubilizing gene from Erwinia herbicola. Biotechnology. 5: 72-74
  • http://pfam.xfam.org/. Pfam 31.0. Febrero 2018
  • http://www.uniprot.org/. UniProt Knowledgebase. Febrero 2018
  • Lamarche, M. G., Wanner, B. L., Crépin, S., Harel, J. (2008). The phosphate regulon and bacterial virulence: a regulatory network connecting phosphate homeostasis and pathogenesis. FEMS microbiology reviews. 32(3): 461-473
  • Liu, S. T., Lee, L. Y., Tai, C. Y., Hung, C. H., Chang, Y. S., Wolfram, J. H., Goldstein, A. H. (1992). Cloning of an Erwinia herbicola gene necessary for gluconic acid production and enhanced mineral phosphate solubilization in Escherichia coli HB101: nucleotide sequence and probable involvement in biosynthesis of the coenzyme pyrroloquinoline quinone. Journal of Bacteriology. 174(18): 5814-5819
  • Mengel, K., Kirkby, E. A., Kosegarten, H., Appel, T. (2001). Principles of plant nutrition. Dordrecht: Springer Netherlands. pp. 481-511
  • NMX-AA-030-SCFI-2001. Norma Mexicana. (2001). Análisis de agua - Determinación de fósforo total en aguas naturales, residuales y residuales tratadas - Método de prueba
  • Omar, S. A. (1997). The role of rock-phosphate-solubilizing fungi and vesicular-arbusular-mycorrhiza (VAM) in growth of wheat plants fertilized with rock phosphate. World Journal of Microbiology and Biotechnology . 14(2): 211-218
  • Paredes-Mendoza, M. Espinoza-Victoria, D. (2010). Ácidos orgánicos producidos por rizobacterias que solubilizan fosfato: una revisión crítica. Terra Latinoamericana, 28: 61-70
  • Pegos, V. R., Nascimento, J. F., Sobreira, T. J. P., Pauletti, B. A., Paes-Leme, A., Balan, A. (2014). Phosphate regulated proteins of Xanthomonas citri subsp. citri: a proteomic approach. Journal of proteomics. 108: 78-88
  • Relwani, L., Krishna, P., Reddy, M. S. (2008). Effect of carbon and nitrogen sources on phosphate solubilization by a wild-type strain and UV-induced mutants of Aspergillus tubingensis. Current microbiology. 57(5): 401-406
  • Rouached, H., Arpat, A. B., Poirier, Y. (2010). Regulation of phosphate starvation responses in plants: signaling players and cross-talks. Molecular Plant. 3(2): 288-299
  • Rubio, P. S., Godoy, M. S., Della, Mónica I. F., Pettinari, M. J., Godeas, A. M., Scervino, J. M. (2016). Carbon and nitrogen sources influence tricalcium phosphate solubilization and extracellular phosphatase activity by Talaromyces flavus. Current microbiology , 72(1), 41-47
  • Satyaprakash, M., Nikitha, T., Reddi, E. U. B., Sadhana, B., Vani, S. S. (2017). Phosphorous and phosphate solubilising bacteria and their role in plant nutrition. Int. J. Curr. Microbiol. App. Sci. 6(4): 2133-2144
  • Sharma, S. B., Sayyed, R. Z., Trivedi, M. H., Gobi, T. A. (2013). Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. SpringerPlus. 2(1): 587
  • Vassileva, M., Azcon, R., Barea, J. M., Vassilev, N. (2000). Rock phosphate solubilization by free and encapsulated cells of Yarrowia lipolytica. Process Biochemistry. 35: 693-697
Historial:
  • » Recibido: 25/04/2018
  • » Aceptado: 03/08/2018
  • » Publición digital: 04/2019

Refbacks

  • There are currently no refbacks.


Copyright (c) 2018 Nova Scientia

Scope

Nova Scientia is a multidisciplinary, electronic publication that publishes biannually in the months of May and November; it is published by the Universidad De La Salle Bajío and aims to distribute unpublished and original papers from the different scientific disciplines written by national and international researchers and academics. It does not publish reviews, bibliographical revisions, or professional applications.

Nova Scientia, year 10, issue 21, November 2018 – April 2019, is a biannual journal printed by the Universidad De La Salle Bajío, with its address: Av. Universidad 602, Col. Lomas del Campestre, C. P. 37150, León, Gto. México. Phone: (52) 477 214 3900, e-mail: http://nova_scientia.delasalle.edu.mx. Chief editor: Ph.D. Ramiro Rico Martínez. ISSN 2007 - 0705. Copyright for exclusive use No. 04-2008-092518225500/102, Diffusion rights via computer net 04 - 2008 – 121011584800-203 both granted by the Instituto Nacional del Derecho de Autor.

Editor responsible for updating this issue: Direction of Research Department of the Universidad De La Salle Bajío, last updated on November 23th, 2018.